Thanks for the reply! I did indeed set my ACD root, and I seem to recall I did that because my EMBOSS applications were trying to access acd files in the unpack directory I installed from rather than the install directory I installed to. This seemed to work.
However, you are right, my EMBOSS_ACDROOT variable has been hijacked by a 3rd party app - grrr!! -----Original Message----- From: [EMAIL PROTECTED] [mailto:[EMAIL PROTECTED] Sent: 23 September 2008 13:29 To: michael watson (IAH-C) Cc: [email protected] Subject: Re: [EMBOSS] New and confusing problem with infoseq! Hello Mick, The -database qualifier was added to infoseq in EMBOSS-5.0.0. The error you're getting would, for example, happen if your EMBOSS 5.0.0 infoseq executable was reading an EMBOSS 4.x.x infoseq.acd file. That could happen if you had set the EMBOSS_ACDROOT environment variable to point to an old ACD directory or, similarly, set an emboss_acdroot in your .embossrc or emboss.default file. For most simple EMBOSS installations you shouldn't need to set EMBOSS_ACDROOT (or equivalent) at all. HTH Alan > Confusing because this didn't happen before and I haven't changed > anything! > > EMBOSS 5.0.0 on RHEL 4. > > Why is infoseq complaining about a database? Has my environment changed > because this used to work exactly how I wanted it to! > > Mick > > -bash-3.00$ infoseq > Displays some simple information about sequences > Input (gapped) sequence(s): Contig0.1399.fasta > Died: Qualifier '-database' not found > > -bash-3.00$ more Contig0.1399.fasta >>lcl|Contig0.1399 No definition line found > AGAGGAGAGGAGAGGACAAAATATGTTATTCCTTGGCAAGTGTTCCCTTGAGAAGGTGTCTGTTAGGGCACA > GTCCATTG > GTGCCTGTGAGGAAAAAGAAGCTGAAGGACTTACTGGGCCACACAGTTGCGACCATCAGAGCTGCCAGCAGC > AGCATGTT > TGCTGCTCCAGCTCAGCTGCTGCTGAGACTCAGAGATGTGTGAGTGAGGCCCCAGATGGGGACATACTGAGT > AGGAGGAG > CTGTCCCCAGCAGTGTTTTTTTTTCTGTGCATAACACCATGGGGCTGTGCTTGTCAAGACGTTACAGCAACC > CGGGAAAT > AAGCAAGACCAGAGAATGCTGAGGTTGTTTTGAAGGAGGTGGTCCTGTCTGCTTTCCTGAGAAATGCAAAGA > ACCGTTGC > TCAGTCCAAGGACTGAAAGGCATGAAGGCTCTTCCAACACAAGCTGTGTTCAGAGCCTCGCAAAACCAGCAC > TATGGAAA > > > > _______________________________________________ > EMBOSS mailing list > [email protected] > http://lists.open-bio.org/mailman/listinfo/emboss > _______________________________________________ EMBOSS mailing list [email protected] http://lists.open-bio.org/mailman/listinfo/emboss
