Hi Horea, Which command are you using to try to run the EMBOSS primer3 wrapper? e.g. eprimer3 or eprimer32?
Sample data, based on your query over at Biopython: https://github.com/biopython/biopython/issues/485 $ curl "http://eutils.ncbi.nlm.nih.gov/entrez/eutils/efetch.fcgi?rettype=fasta&tool=biopython&db=nucleotide&id=aj627603&retmode=text"; -o AJ627603.fasta % Total % Received % Xferd Average Speed Time Time Time Current Dload Upload Total Spent Left Speed 100 7412 0 7412 0 0 7245 0 --:--:-- 0:00:01 --:--:-- 9050 Locally I get: $ eprimer3 --version EMBOSS:6.5.7.0 $ eprimer3 -auto -sequence AJ627603.fasta -out AJ627603.eprimer3 $ cat AJ627603.eprimer3 # EPRIMER3 RESULTS FOR AJ627603.1 # Start Len Tm GC% Sequence 1 PRODUCT SIZE: 201 FORWARD PRIMER 4896 20 59.97 55.00 GGAGTACTTCCAACCGGTCA REVERSE PRIMER 5077 20 59.98 55.00 CTGAGGCTTTGACCCAGAAG 2 PRODUCT SIZE: 200 FORWARD PRIMER 5783 20 60.12 50.00 GCACTGATTTCGACCAGGTT REVERSE PRIMER 5963 20 59.89 50.00 GCTAACCAGCGTTTTCGTTC 3 PRODUCT SIZE: 195 FORWARD PRIMER 4896 20 59.97 55.00 GGAGTACTTCCAACCGGTCA REVERSE PRIMER 5071 20 59.98 55.00 CTTTGACCCAGAAGCCAGAG 4 PRODUCT SIZE: 201 FORWARD PRIMER 4855 20 59.83 60.00 GACCTGGTAGGCTCAGATGC REVERSE PRIMER 5036 20 60.09 55.00 TTCTCTTGGTCCCAGTCCAC 5 PRODUCT SIZE: 203 FORWARD PRIMER 2750 20 59.98 50.00 AGACAATCGGCTGCTCTGAT REVERSE PRIMER 2933 20 59.84 55.00 CAATAGCAGCCAGTCCCTTC (It looks like we have the old version of primer3 installed locally?) $ eprimer32 --version EMBOSS:6.5.7.0 $ eprimer32 Pick PCR primers and hybridization oligos Died: eprimer32 uses external program 'primer32_core' which is not in the PATH or defined as EMBOSS_PRIMER32_CORE Part of the 'primer3' package, version 2.2.3, available from the Whitehead Institute. See: http://primer3.sourceforge.net/ The primer3_core application must be renamed to primer32_core Peter On Sat, Mar 28, 2015 at 10:28 PM, Horea Christian <[email protected]> wrote: > I was able to reproduce this issue with primer3-2.3.6 as well. > > > On Sa, 2015-03-28 at 22:42 +0100, Horea Christian wrote: > > As seen in this discussion [https://www.biostars.org/p/102268/] primer3 > (primer3_core) needs the SEQUENCE_TEMPLATE to be set in a config file. > Apparently eprimer does not do this. > > This discussion > [https://www.mail-archive.com/[email protected]/msg01980.html] is > referenced in the above thread to support the claim that primer32 should be > used instead, but it actually states that the proper function to use for > primer3-2.3.* is primer3. > > My versions: > emboss-6.6.0 > primer3-2.3.5 > > Could you help me out? > > _______________________________________________ > EMBOSS mailing list > [email protected] > http://mailman.open-bio.org/mailman/listinfo/emboss > > > > _______________________________________________ > EMBOSS mailing list > [email protected] > http://mailman.open-bio.org/mailman/listinfo/emboss _______________________________________________ EMBOSS mailing list [email protected] http://mailman.open-bio.org/mailman/listinfo/emboss
