Hello all!
('Scuse me if all this seems stupid, but I'm a biologist, trying to get
into programming! I posted a similar question to gnome-dev already, but
got no help ;-) )
Background:
==========
I'm looking into ways of formatting DNA (the genetic code, to avoid
ambiguity!) sequences, which are usually formatted onto 60 characters
per line, with no line wrapping.
Additionally, I'm numbering the sequences down the side of a window, so
I end up with a 2 column format like so:
------------------------------------
| 0 - 60 | GATGATGAGTGAGTTGAGTGA |
| 61- 120 | GATGATGTTTGAGTTGAGTGA |
| 121-181 | GTTCATGAGTGAGTTCCGTGA |
------------------------------------
I'd like the sequences to be highlight-able, so as to perform
cut/copy/paste functions, just like using the GtkText widget (but that
wants me to do line-wrapping, I think.).
So:
========
I've been playing withe the GnomeCanvasText, which looks really nice,
and does the formatting how I like it, but I don't see quite how I can
get highlighting/cut/copy/paste functionality going with it! (Is there
any straightforward way of doing this?)
A useful starting point for the type of layout I'm looking for is the
Evolution addressbook/contacts window, which is even better, because the
columns are re-sizeable. I'm a bit lost in the Evolution code though
(I'm a newbie, of course!).
Does anyone either have some example code to do something like this, or
can anyone point me to the Evolution source files which set up the
"Contacts" window please? Or even could someone describe briefly how
it's done. (I can't use Bonobo and advanced stuff like that, I'm just
getting to grips with vanilla Gnome/GTK/Glade so far)
I guess the source files should be in $ev-toplevel/addressbook/gui', but
I'm completely lost in there. Is it done in Evolution by a GtkText
widget which is embedded into a Canvas?
If not, how can I emulate the contacts/addressbook 2 column-format,
whilst retaining cut/copy/paste functionality please.
If anyone is really interested, I can give screenshots of what I'm doing
as an example......
Thanks in advance for any help.
Mark
--
Mark Brooks,
EMBL Grenoble Outstation,
6, rue Jules Horowitz, BP181
38042 Grenoble Cedex 9, France.
Tel: + (0)4 76 20 72 85
_______________________________________________
evolution-hackers maillist - [EMAIL PROTECTED]
http://lists.ximian.com/mailman/listinfo/evolution-hackers