>From what you say, it really sounds like what you want to do is use
ETable. Try View->Current View->Phone List and see if you don't think
that might make a better interface.
I'm not sure if this level of code is a great idea for a beginning
programmer though. Hmm. I'm still working on documentation for
ETable. It's documented in the code for the most part, but I'm not sure
how to build the code from there.
If you try, just come to me with any questions. I'm totally willing to
answer any questions about ETable. It will especially help me to make
the documentation stronger.
If you don't think that's as good an interface, I can answer questions
about the minicard view, but that's even less documented. I'm totally
willing to help you understand the code in evolution so you can reuse
it.
Good luck,
Chris
On Thu, 2001-12-06 at 13:24, Brooks Mark wrote:
> Hello all!
> ('Scuse me if all this seems stupid, but I'm a biologist, trying to get
> into programming! I posted a similar question to gnome-dev already, but
> got no help ;-) )
>
> Background:
> ==========
> I'm looking into ways of formatting DNA (the genetic code, to avoid
> ambiguity!) sequences, which are usually formatted onto 60 characters
> per line, with no line wrapping.
> Additionally, I'm numbering the sequences down the side of a window, so
> I end up with a 2 column format like so:
>
> ------------------------------------
> | 0 - 60 | GATGATGAGTGAGTTGAGTGA |
> | 61- 120 | GATGATGTTTGAGTTGAGTGA |
> | 121-181 | GTTCATGAGTGAGTTCCGTGA |
> ------------------------------------
>
> I'd like the sequences to be highlight-able, so as to perform
> cut/copy/paste functions, just like using the GtkText widget (but that
> wants me to do line-wrapping, I think.).
>
> So:
> ========
> I've been playing withe the GnomeCanvasText, which looks really nice,
> and does the formatting how I like it, but I don't see quite how I can
> get highlighting/cut/copy/paste functionality going with it! (Is there
> any straightforward way of doing this?)
>
> A useful starting point for the type of layout I'm looking for is the
> Evolution addressbook/contacts window, which is even better, because the
> columns are re-sizeable. I'm a bit lost in the Evolution code though
> (I'm a newbie, of course!).
>
> Does anyone either have some example code to do something like this, or
> can anyone point me to the Evolution source files which set up the
> "Contacts" window please? Or even could someone describe briefly how
> it's done. (I can't use Bonobo and advanced stuff like that, I'm just
> getting to grips with vanilla Gnome/GTK/Glade so far)
>
> I guess the source files should be in $ev-toplevel/addressbook/gui', but
> I'm completely lost in there. Is it done in Evolution by a GtkText
> widget which is embedded into a Canvas?
>
> If not, how can I emulate the contacts/addressbook 2 column-format,
> whilst retaining cut/copy/paste functionality please.
>
> If anyone is really interested, I can give screenshots of what I'm doing
> as an example......
>
> Thanks in advance for any help.
>
> Mark
>
> --
> Mark Brooks,
> EMBL Grenoble Outstation,
> 6, rue Jules Horowitz, BP181
> 38042 Grenoble Cedex 9, France.
> Tel: + (0)4 76 20 72 85
>
>
>
>
> _______________________________________________
> evolution-hackers maillist - [EMAIL PROTECTED]
> http://lists.ximian.com/mailman/listinfo/evolution-hackers
_______________________________________________
evolution-hackers maillist - [EMAIL PROTECTED]
http://lists.ximian.com/mailman/listinfo/evolution-hackers
