Hello,

When I use the NGS Picard tool "SAM/BAM alignment summary metrics" with a BAM 
file produced with Tophat in Galaxy I get the following message:

INFO:root:## executing java -Xmx4g -jar 
/galaxy/home/g2main/galaxy_main/tool-data/shared/jars/CollectAlignmentSummaryMetrics.jar
 VALIDATION_STRINGENCY=LENIENT ASSUME_SORTED=true  ADAPTER_SEQUENCE= 
IS_BISULFITE_SEQUENCED=false MAX_INSERT_SIZE=1000 
OUTPUT=/galaxy/main_pool/pool5/tmp/job_working_directory/2368774/dataset_2672529_files/CollectAlignmentSummaryMetrics.metrics.txt
 
R=/galaxy/main_pool/pool5/tmp/job_working_directory/2368774/dataset_2672529_files/mm9.fa_fake.fasta
 TMP_DIR=/tmp INPUT=/galaxy/main_database/files/002/666/dataset_2666199.dat 
returned status 1 and stderr:
[Mon Jul 11 03:27:56 EDT 2011] 
net.sf.picard.analysis.CollectAlignmentSummaryMetrics MAX_INSERT_SIZE=1000 
ADAPTER_SEQUENCE=[AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT, 
AGATCGGAAGAGCTCGTATGCCGTCTTCTGCTTG, 
AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT, 
AGATCGGAAGAGCGGTTCAGCAGGAATGCCGAGACCGATCTCGTATGCCGTCTTCTGCTTG, 
AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT, 
AGATCGGAAGAGCACACGTCTGAACTCCAGTCACNNNNNNNNATCTCGTATGCCGTCTTCTGCTTG, 
IS_BISULFITE_SEQUENCED=false] 
INPUT=/galaxy/main_database/files/002/666/dataset_2666199.dat 
OUTPUT=/galaxy/main_pool/pool5/tmp/job_working_directory/2368774/dataset_2672529_files/CollectAlignmentSummaryMetrics.metrics.txt
 
REFERENCE_SEQUENCE=/galaxy/main_pool/pool5/tmp/job_working_directory/2368774/dataset_2672529_files/mm9.fa_fake.fasta
 ASSUME_SORTED=true TMP_DIR=/tmp VALIDATION_STRINGENCY=LENIENT    
IS_BISULFITE_SEQUENCED=false STOP_AFTER=0 VERBOSITY=INFO QUIET=false 
COMPRESSION_LEVEL=5 MAX_RECORDS_IN_RAM=500000 CREATE_INDEX=false 
CREATE_MD5_FILE=false
[Mon Jul 11 03:27:57 EDT 2011] 
net.sf.picard.analysis.CollectAlignmentSummaryMetrics done.
Runtime.totalMemory()=507379712
Exception in thread "main" java.lang.IllegalArgumentException: No enum const 
class net.sf.samtools.SAMFileHeader$SortOrder.sorted
  at java.lang.Enum.valueOf(Enum.java:196)
  at net.sf.samtools.SAMFileHeader$SortOrder.valueOf(SAMFileHeader.java:58)
  at net.sf.samtools.SAMFileHeader.getSortOrder(SAMFileHeader.java:239)
  at 
net.sf.picard.analysis.SinglePassSamProgram.makeItSo(SinglePassSamProgram.java:85)
  at 
net.sf.picard.analysis.SinglePassSamProgram.doWork(SinglePassSamProgram.java:54)
  at 
net.sf.picard.cmdline.CommandLineProgram.instanceMain(CommandLineProgram.java:157)
  at 
net.sf.picard.cmdline.CommandLineProgram.instanceMainWithExit(CommandLineProgram.java:117)
  at 
net.sf.picard.analysis.CollectAlignmentSummaryMetrics.main(CollectAlignmentSummaryMetrics.java:106)


If  I use the NGS: Picard BAM Index Statistics, the script is running without 
any failure so I think the BAM format should be okay.
Any help would be gratefully received.

Thanks.

Andreas Huge


___________________________________________________________
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org.  Please keep all replies on the list by
using "reply all" in your mail client.  For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:

  http://lists.bx.psu.edu/listinfo/galaxy-dev

To manage your subscriptions to this and other Galaxy lists,
please use the interface at:

  http://lists.bx.psu.edu/

Reply via email to