Hi Haluk,
It is definitely not conventional to remove bases that have low quality, because this disrupts the DNA sequence and may introduce frameshifts. It is typically better to trim the ends of the sequence, or to remove it altogether if its quality does not match your requirements.
Regards,
Florent


On 31/07/11 18:40, Haluk Dogan wrote:
Hi Florent,

I actually want to do removing respected bases if their quality score is less than my threshold. I had been able to do masking those bases by using FASTQ Masker by quality score tool.
But I haven't gone even one step further for removing bases.

After your reply, I got suspicious. Am I trying to do something wrong in theory?

Thanks in advance.

On Sun, Jul 31, 2011 at 6:07 AM, Florent Angly <[email protected] <mailto:[email protected]>> wrote:

    Hi Haluk,
    By filtering, you mean removing reads? trimming their ends? or
    masking some of their bases?
    There are 3 tools under "Generic FASTQ manipulation" that may help
    you:
        Filter FASTQ reads by quality score and length
        FASTQ Quality Trimmer by sliding window
        FASTQ Masker by quality score
    Regards,
    Florent


    On 31/07/11 05:58, Haluk Dogan wrote:
    Hi,

    I am trying to filter my fastq file with the condition of if
    quality score of reads is less then min score.

    So far, I have tried both *fastq_quality_filter* and *Filter
    FASTQ under NGS: QC and manipulation** *but I was not be able to
    do it.

    In the following you can see my fastq file.

    @F4HZV5G02CX6WP rank=0000096 x=1092.0 y=1767.0 length=45
    TTGAGCAGCGGCGTCACGGCGGCGGCCTCGGCGGCCGCATAGGCG
    +
    FFFFFFFFFFFIIIIIIIIIIIIIIIIIIIIIIIIIHFFDDBDA>

    And these are quality scores.
    [37, 37, 37, 37, 37, 37, 37, 37, 37, 37, 37, 40, 40, 40, 40, 40,
    40, 40, 40, 40, 40, 40, 40, 40, 40, 40, 40, 40, 40, 40, 40, 40,
    40, 40, 40, 40, 39, 37, 37, 35, 35, 33, 35, 32, 29]

    I want to filter bases if their quality scores are less than 33.

    Any help would be greatly appreciated.

-- HD



    ___________________________________________________________
    The Galaxy User list should be used for the discussion of
    Galaxy analysis and other features on the public server
    atusegalaxy.org  <http://usegalaxy.org>.  Please keep all replies on the 
list by
    using "reply all" in your mail client.  For discussion of
    local Galaxy instances and the Galaxy source code, please
    use the Galaxy Development list:

       http://lists.bx.psu.edu/listinfo/galaxy-dev

    To manage your subscriptions to this and other Galaxy lists,
    please use the interface at:

       http://lists.bx.psu.edu/




--
HD

___________________________________________________________
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org.  Please keep all replies on the list by
using "reply all" in your mail client.  For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:

  http://lists.bx.psu.edu/listinfo/galaxy-dev

To manage your subscriptions to this and other Galaxy lists,
please use the interface at:

  http://lists.bx.psu.edu/

Reply via email to