Thank you for the response. I can't check my reference genome dataset because I'm using reference provided by Galaxy (*Mosquito (Anopheles gambiae): AgamP3*). Is there any solution? Thank you.
-- Chandu On Mon, Oct 10, 2011 at 7:15 AM, Jeremy Goecks <[email protected]>wrote: > > Tool execution generated the following error message: > > Error running cuffcompare. Warning: Your version of Cufflinks is not > up-to-date. It is recommended that you upgrade to Cufflinks v1.1.0 to benefit > from the most recent features and bug fixes (http://cufflinks.cbcb.umd.edu). > No fasta index found for ./input1. Rebuilding, please wait.. > Error: sequence lines in a FASTA record must have the same length! > > Chandu, > > Cufflinks/compare/diff requires that your reference genome dataset have the > following format: > > >my_chrom > AGTTACCGGTAGTTACCGGTAGTTACCGGTAGTTACCGGTAGTTACCGGTAGTTACCGGT > AGTTACCGGTAGTTACCGGTAGTTACCGGTAGTTACCGGTAGTTACCGGTAGTTACCGGT > AGTTACCGGTAGTTACCGGTAGTTACCGGTAGTTACCGGTAGTTACCGGTAGTTACCGGT > ... > > Note that all lines of sequence data have the same length. > > The problem you're seeing is because there are lines in your sequence data > that are not the same length, e.g. > > >my_chrom > AGTTACCGGTAGTTACCGGTAGTTACCGGTAGTTACCGGTAGTTACCGGTAGTTACCGGT > AGTTACCGGTAGTTACCGGTAGTTACCGGTAGTTACCGGTAGTTACCGGTAGTTA > AGTTACCGGTAGTTACCGGTAGTTACCGGTAGTTACCGGTAGTTACCGGTAGTTACCG > ... > > The FASTA Width tool in Galaxy can help you format your dataset correctly. > > Good luck, > J. >
___________________________________________________________ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using "reply all" in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/

