Hi,
I am trying to join two groomed fastq files from a paired-end Illumina
read using the fastq joiner tool. The drop-down menus correctly
identify the groomed fastq files, but after cranking for a few minutes
the tool produces empty output:

"FASTQ joiner on data 5 and data 4emptyformat: fastqsanger, database:
?Info: There were 3497909 known sequence reads not utilized.Joined 0
of 3497909 read pairs (0.00%)."

The files have the same number of reads (3497909), reads have the same
number of bases (102), and the joiner tool doesn't have any options
(other than choosing the two files to join). I have tried this with
Sanger and with Illumina 1.3+ quality scores, and in both (left-right)
orientations. I've pasted the beginnings of the two files below my
signature in case this is useful for diagnosing the problem.
Can anyone tell me what I'm doing wrong?  Thanks,
-- 
Matthew D. Herron, PhD
Department of Zoology
University of British Columbia
[email protected]
http://www.eebweb.arizona.edu/grads/mherron/

Sample of read 1:
@HWI-ST765:83:D091AACXX:1:1101:1202:2130 1:N:0:ACTTGA
TTATTCCGTTTACCTTCACGCTGTTATGGCTCTCGGTGTTCGGCAATAGCGCGCTGTATGAAATTATCCACGGCGGCGCGGCATTTGCCGAGGAAGCGATG
+
CCCFFFFFHHHHHJJJJJJJJJJJJIJIJJJIEHII?FGIIJJJJJJJIJJJHFFDDEEEDEDDDDEDDDDDDDDDDDDDDDDDDD@CCD3<BDD@DDDBD

Sample of read 2:
@HWI-ST765:83:D091AACXX:1:1101:1202:2130 2:N:0:ACTTGA
ATTCCCCAGCACCAGCGCCCCGGAGTCCGCCGAGGTCACATAAAACAGCAGGCCAGTAATGGTGGCGACGGAGGCGCTAAAGGTAAACGCCGGATACTGCG
+
CCCFFFFFFGHHHJJJJJJJJJIJIFHIIJJJJIG:BEFFFFEEEDDCBDDDDDDD@CDDDCACDDDBDDDDDDBDDDDDDDC>@CCC@@DDDDDDDDEDB
___________________________________________________________
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org.  Please keep all replies on the list by
using "reply all" in your mail client.  For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:

  http://lists.bx.psu.edu/listinfo/galaxy-dev

To manage your subscriptions to this and other Galaxy lists,
please use the interface at:

  http://lists.bx.psu.edu/

Reply via email to