I'm having the same issue (though with interlacer). I suspect that
it's an issue with the way the forward and reverse are read. Mine look
like yours, where forward is 1:N and reverse is 2:N instead of the /1
and /2 that the tool says that it expects. Our data are Illumina
pipeline 1.9 (HiSeq), so maybe that's the problem? I don't actually
know, however, or how to fix this. Just interesting to have run into
this problem today and then seen your email.

-Lucinda

On Tue, Nov 8, 2011 at 2:19 PM, Matthew Herron <[email protected]> wrote:
> Hi,
> I am trying to join two groomed fastq files from a paired-end Illumina
> read using the fastq joiner tool. The drop-down menus correctly
> identify the groomed fastq files, but after cranking for a few minutes
> the tool produces empty output:
>
> "FASTQ joiner on data 5 and data 4emptyformat: fastqsanger, database:
> ?Info: There were 3497909 known sequence reads not utilized.Joined 0
> of 3497909 read pairs (0.00%)."
>
> The files have the same number of reads (3497909), reads have the same
> number of bases (102), and the joiner tool doesn't have any options
> (other than choosing the two files to join). I have tried this with
> Sanger and with Illumina 1.3+ quality scores, and in both (left-right)
> orientations. I've pasted the beginnings of the two files below my
> signature in case this is useful for diagnosing the problem.
> Can anyone tell me what I'm doing wrong?  Thanks,
> --
> Matthew D. Herron, PhD
> Department of Zoology
> University of British Columbia
> [email protected]
> http://www.eebweb.arizona.edu/grads/mherron/
>
> Sample of read 1:
> @HWI-ST765:83:D091AACXX:1:1101:1202:2130 1:N:0:ACTTGA
> TTATTCCGTTTACCTTCACGCTGTTATGGCTCTCGGTGTTCGGCAATAGCGCGCTGTATGAAATTATCCACGGCGGCGCGGCATTTGCCGAGGAAGCGATG
> +
> CCCFFFFFHHHHHJJJJJJJJJJJJIJIJJJIEHII?FGIIJJJJJJJIJJJHFFDDEEEDEDDDDEDDDDDDDDDDDDDDDDDDD@CCD3<BDD@DDDBD
>
> Sample of read 2:
> @HWI-ST765:83:D091AACXX:1:1101:1202:2130 2:N:0:ACTTGA
> ATTCCCCAGCACCAGCGCCCCGGAGTCCGCCGAGGTCACATAAAACAGCAGGCCAGTAATGGTGGCGACGGAGGCGCTAAAGGTAAACGCCGGATACTGCG
> +
> CCCFFFFFFGHHHJJJJJJJJJIJIFHIIJJJJIG:BEFFFFEEEDDCBDDDDDDD@CDDDCACDDDBDDDDDDBDDDDDDDC>@CCC@@DDDDDDDDEDB
> ___________________________________________________________
> The Galaxy User list should be used for the discussion of
> Galaxy analysis and other features on the public server
> at usegalaxy.org.  Please keep all replies on the list by
> using "reply all" in your mail client.  For discussion of
> local Galaxy instances and the Galaxy source code, please
> use the Galaxy Development list:
>
>  http://lists.bx.psu.edu/listinfo/galaxy-dev
>
> To manage your subscriptions to this and other Galaxy lists,
> please use the interface at:
>
>  http://lists.bx.psu.edu/
>



-- 
Lucinda Lawson
Postdoctoral Research Computational Biologist
USDA-ARS
Gainesville, FL

___________________________________________________________
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org.  Please keep all replies on the list by
using "reply all" in your mail client.  For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:

  http://lists.bx.psu.edu/listinfo/galaxy-dev

To manage your subscriptions to this and other Galaxy lists,
please use the interface at:

  http://lists.bx.psu.edu/

Reply via email to