Hi We're a bit confused about exactly how the adaptor clipping tool works. Is there some documentation that describes how it does the clipping? In the clipping example given on the Galaxy page for "Clip adapter sequences" (the adaptor is CTGTAGGCACCATCATTATTTATATAA ):
* How large a substring of the sequence must the adaptor be in order for it to be clipped? E.g., if the sequence is ATGGACTCTG, it seems to clip the terminal CTG, but it doesn't clip if CTG appears somewhere in the middle of a sequence. * Does it clip if, say, the middle part of the adaptor appears somewhere in the middle of a sequence, and if so, how long must it be before it clips? Thank you, Francisc Raul Kantor
___________________________________________________________ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using "reply all" in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/
