Hello,

The Table Browser is an excellent tool for finding out more about a track's 
table(s) and related tracks that may be of interest.

http://genome.ucsc.edu/cgi-bin/hgTables

In addition to the two track's you mention, the RepeatMasker track may be 
helpful. 

To view contents description, open table in the table browser then, click on 
"describe table schema" to view the field definitions.
Alternatively, in Downloads, the file by the same name followed by a ".sql" 
also has the table schema.

General table browser help:
http://genome.ucsc.edu/goldenPath/help/hgTracksHelp.html#TableBrowser

Thanks, jenn

------------------------------------------------ 
Jennifer Jackson 
UCSC Genome Bioinformatics Group 

----- "배재범" <[email protected]> wrote:

> From: "배재범" <[email protected]>
> To: [email protected]
> Sent: Monday, August 31, 2009 3:45:56 AM GMT -08:00 US/Canada Pacific
> Subject: [Genome] database query
>
> Hi
> 
> I am JaeBum Bae in Yonsei University, Seoul, Korea.
> 
> Thank you for your great efforts on maintaining such a nice and
> comprehensive database in public.
> 
> I have questions on genome browser database system hg18 assembly
> (March 2006 Assembly Mammal Human)
> 
> I tried to access to repeat database ( Simplerepeat.txt) and CpG
> database
> (CpgIslandExt.txt), and downloaded form your web site.
> 
> First, can you show what is the head line for Simplerepeat.txt
> 
> for example in this file ,  it starts like this with no header
> information. I would like to know what is exact meaning on each
> column.
> 
>     585
>  chr1
>  0
>  468
>  trf
>  6
>  77.2
>  6
>  95
>  3
>  789
>  33
>  51
>  0
>  15
>  1.43
>  TAACCC
> 
> 
>  585
>  chr1
>  620
>  860
>  trf
>  76
>  3.2
>  76
>  95
>  2
>  434
>  17
>  30
>  45
>  6
>  1.73
> 
> GGCGCAGGCGCAGAGAGGCGCGCCGCGCCGGCGCAGGCGCAGAGACACATGCTAGCGCGTCCAGGGGTGGAGGCGT
> 
> amd also could you show me how to access SINE, LINE database each...
> Second, In cpgIslandsExt.txt, I can find only CpG Island location at
> the
> promoter region, but in your browser, CpG islands is also appearing on
> genic
> (genebody) region. So I would like to know whether these information
> is also
> available in your database as a downloadable format.
> 
> 
> Thank you for your generous help in advance
> 
> 
> JaeBum Bae
> _______________________________________________
> Genome maillist  -  [email protected]
> https://lists.soe.ucsc.edu/mailman/listinfo/genome

_______________________________________________
Genome maillist  -  [email protected]
https://lists.soe.ucsc.edu/mailman/listinfo/genome

Reply via email to