Hello.I search to define the sequence of an amplicon for the gene inhbb in Mus musculus (NM_008381.3). I have already two primers (fwd : TTTGCAGAGACAGATGGCCTCG and rev : GCCTGCACCACGAATAGGTTCT). I have search in "PCR" but I have the following message : *UCSC In-Silico PCR* No matches to tttgcagagacagatggcctcg agaacctattcgtggtgcaggc in UCSC Genes
What can I do? Thank you very much. Anne (PhD student) _______________________________________________ Genome maillist - [email protected] https://lists.soe.ucsc.edu/mailman/listinfo/genome
