Hello.I search to define the sequence of an amplicon for the gene inhbb in
Mus musculus (NM_008381.3). I have already two primers (fwd :
TTTGCAGAGACAGATGGCCTCG
and rev : GCCTGCACCACGAATAGGTTCT). I have search in "PCR" but I have the
following message :
*UCSC In-Silico PCR* No matches to tttgcagagacagatggcctcg
agaacctattcgtggtgcaggc in UCSC Genes

What can I do?
Thank you very much.
Anne (PhD student)
_______________________________________________
Genome maillist  -  [email protected]
https://lists.soe.ucsc.edu/mailman/listinfo/genome

Reply via email to