Hello, The current UCSC Gene "Mouse Gene Inhbb (uc007cir.1)" has associated the RefSeq NM_008381. (Note there is no ".3"). The latest version of the RefSeq is very new (early Sept.) and has not been incorporated in the current UCSC Genes track yet.
The UCSC Genes page has links for help with primer design - look in the section "Sequence and Links to Tools and Databases" and click on ExonPrimer. Good luck, Jennifer ------------------------------------------------ Jennifer Jackson UCSC Genome Bioinformatics Group ----- "Anne ABOT" <[email protected]> wrote: > From: "Anne ABOT" <[email protected]> > To: [email protected] > Sent: Friday, October 9, 2009 3:29:43 AM GMT -08:00 US/Canada Pacific > Subject: [Genome] (no subject) > > Hello.I search to define the sequence of an amplicon for the gene > inhbb in > Mus musculus (NM_008381.3). I have already two primers (fwd : > TTTGCAGAGACAGATGGCCTCG > and rev : GCCTGCACCACGAATAGGTTCT). I have search in "PCR" but I have > the > following message : > *UCSC In-Silico PCR* No matches to tttgcagagacagatggcctcg > agaacctattcgtggtgcaggc in UCSC Genes > > What can I do? > Thank you very much. > Anne (PhD student) > _______________________________________________ > Genome maillist - [email protected] > https://lists.soe.ucsc.edu/mailman/listinfo/genome _______________________________________________ Genome maillist - [email protected] https://lists.soe.ucsc.edu/mailman/listinfo/genome
