Hi Galt,
Here is the command that I use. You mentioned "Generally people don't
much bother with using BLAT's own commandline options for minScore,
etc." But I want to understand what minScore is and when it can be
ignored. Would you please let me know?
$ blat -t=dna -q=dna -stepSize=5 -minScore=25 -maxGap=0 -noHead \
database.fasta \
query.fasta \
query.psl
$ cat query.fasta
>test_sequence
cttgcaccggaaagtctgctccaga
$ cat database.fasta
>database_chr1
ctagcaccggaaagtctgctccaga
$ cat query.psl
24 1 0 0 0 0 0 0 +
test_sequence 25 0 25 database_chr1 25 0 25
1 25, 0, 0,
On Mon, Apr 26, 2010 at 4:30 PM, Jennifer Jackson <[email protected]> wrote:
> Hello Peng,
>
> Very sorry, your reply went to the genome mailing list only, not to your
> email address as well. Our apologies.
>
> Here is the posting:
> https://lists.soe.ucsc.edu/pipermail/genome/2010-April/022012.html
>
> Jennifer
>
> ---------------------------------
> Jennifer Jackson
> UCSC Genome Informatics Group
> http://genome.ucsc.edu/
>
> On 4/24/10 12:09 PM, Peng Yu wrote:
>>
>> Could somebody answer me the following question?
>>
>> On Wed, Apr 21, 2010 at 2:48 PM, Peng Yu<[email protected]> wrote:
>>>
>>> I'm wondering what "some sort of gap penalty" refers to. Also I query
>>> 25bp sequence using the default, BLAT still gives the result. By
>>> definition 25bp sequence should at most have a score of 25, which is
>>> less than 30. Why the query still returns the the result?
>>>
>>> -minScore=N sets minimum score. This is the matches minus the
>>> mismatches minus some sort of gap penalty. Default is 30
>>>
>>>
>>> --
>>> Regards,
>>> Peng
>>>
>>
>>
>>
>
--
Regards,
Peng
_______________________________________________
Genome maillist - [email protected]
https://lists.soe.ucsc.edu/mailman/listinfo/genome
