Looks like you'd have to just get the whole kent source.
http://hgdownload.cse.ucsc.edu/admin/jksrc.zip
There are several fixes which are done
but not officially released yet as version 35.
Here are the unreleased fixes from blat/version.doc:
o (in 34x1) Making total query output reporting a 64 bit number to avoid
overflow when people using more than 4 gig of query sequence.
o (in 34x2) Fixed -out=blast to use +/- instead of -/+ for non-translated.
o (in 34x3) Fixed -minScore, filter was not working when over half
query-size.
o (in 34x4) Made it convert u's to t's for RNA sequence stuff.
o (in 34x5) Made gfServer calculate repMatch based on
stepSize/tileSize combination the way blat does
rather than just being good for stepSize 11.
o (in 34x6) Fixed negative strand pcr psl output
o (in 34x7) Made it check and error out if the same name is reused in
the target database.
From looking at the usual BLAT source package,
these are the only files/subdirs you need to keep:
Apr 20 2007 blatSrc34.zip
blatSrc
cd blatSrc
blatSrc> ls -l
-rw-rw-r-- 1438 Feb 18 2005 README
drwxrwxr-x 512 Apr 29 10:35 blat
drwxrwxr-x 512 Apr 20 2007 gfClient
drwxrwxr-x 512 Apr 20 2007 gfServer
drwxrwxr-x 512 Feb 10 2004 hg
drwxrwxr-x 3072 Apr 20 2007 inc
drwxrwxr-x 512 Apr 20 2007 jkOwnLib
drwxrwxr-x 3584 Apr 20 2007 lib
-rw-rw-r-- 402 Dec 16 2005 makefile
drwxrwxr-x 512 Mar 25 2004 utils
drwxrwxr-x 512 Apr 20 2007 webBlat
The README just has this to say:
---
CONTENTS AND COPYRIGHT
This archive contains the entire source tree for BLAT and
associated utilities. All files are copyrighted, but license
is hereby granted for personal, academic, and non-profit use.
A license is also granted for the contents of the top level
lib and inc directories for commercial users. Commercial
users should contact [email protected] for access to other modules.
INSTALL INSTRUCTIONS
1. Unzip this to create a blatSrc directory.
2. Check that the environment variable MACHTYPE
exists on your system. It should on Unix.
(And making this on non-Unix systems is beyond
the scope of this README). For a Linux
system MACHTYPE will probably be 'i386', for
and Alpha it will be 'alpha', for a Sun
probably 'sparc'. If necessary set up
this environment variable. Do this under the
bash shell as so:
MACHTYPE=something
export MACHTYPE
or under tcsh as so:
setenv MACHTYPE something
3. Make the directory ~/bin/$MACHTYPE which is
where the (non-web) executables will go.
Add this directory to your path.
4. Go to the lib directory. If it doesn't
already exist do a mkdir $MACHTYPE.
5. If you're on an alpha system do a:
setenv SOCKETLIB -lxnet
on Solaris do
setenv SOCKETLIB "-lsocket -lnsl"
on SunOS do
setenv SOCKETLIB "-lsocket -lnsl -lresolv"
on Linux you can skip this step.
6. At the blatSrc directory type 'make'
---
Here is the makefile:
---
all:
cd lib && ${MAKE}
cd jkOwnLib && ${MAKE}
cd blat && $(MAKE)
cd gfClient && $(MAKE)
cd gfServer && $(MAKE)
cd hg/pslPretty && $(MAKE)
cd hg/pslReps && $(MAKE)
cd hg/pslSort && $(MAKE)
cd utils/nibFrag && $(MAKE)
cd utils/faToNib && $(MAKE)
cd utils/faToTwoBit && $(MAKE)
cd utils/twoBitToFa && $(MAKE)
cd utils/twoBitInfo && $(MAKE)
cd webBlat && $(MAKE)
clean:
rm -f */*.o */*/*.o
---
This should be enough for you to
download and compile the latest blat source.
Obviously, this should come with the simple
warning that this is pre-official release
code. However, we have been using it here
without trouble.
As usual with BLAT, it's good to remind people
that the software is licensed. It's only free
for academic, personal, non-commericial use.
Commercial licenses may be purchased.
-Galt
Ar 4/29/2010 9:47 AM, scríobh Peng Yu:
> On Tue, Apr 27, 2010 at 9:00 PM, Galt Barber<[email protected]> wrote:
>>
>> Hi, Peng!
>>
>> As the FAQ points out
>> http://genome.ucsc.edu/FAQ/FAQblat.html
>>
>> "A note on filtering output: increasing the -minScore parameter value beyond
>> one-half of the query size has no further effect. Therefore, use either the
>> pslReps or pslCDnaFilter program available in the Genome Browser source
>> code to filter for the size, score, coverage, or quality desired. For
>> information on obtaining the source code, see our FAQ on source code
>> licensing and downloads. "
>>
>> This seems to have been an odd restriction
>> which was removed at the urging of users,
>> however, the change came only in 2008:
>>
>> blat/version.doc
>> 1.72 (galt 09-Dec-08): (in blat version 34x3)
>> Fixed -minScore, filter was not working when over half query-size.
>> v197_branch: 1.72.0.2
>>
>> revision 1.72
>> date: 2008/12/09 08:11:46; author: galt; state: Exp; lines: +1 -0
>> fixing minScore
>> ----------------------------
>>
>> galt
>> Tue Dec 9 08:11:46 2008 +0000
>> fixing minScore
>> diff --git src/jkOwnLib/gfBlatLib.c src/jkOwnLib/gfBlatLib.c
>> --- src/jkOwnLib/gfBlatLib.c
>> +++ src/jkOwnLib/gfBlatLib.c
>> @@ -18,7 +18,7 @@
>>
>>
>> static void saveAlignments(char *chromName, int chromSize, int chromOffset,
>> struct ssBundle *bun, struct hash *t3Hash,
>> boolean qIsRc, boolean tIsRc,
>> enum ffStringency stringency, int minMatch, struct gfOutput *out)
>> /* Save significant alignments to file in .psl format. */
>> {
>> struct dnaSeq *tSeq = bun->genoSeq, *qSeq = bun->qSeq;
>> struct ssFfItem *ffi;
>> -if (minMatch> qSeq->size/2) minMatch = qSeq->size/2;
>> -if (minMatch< 1) minMatch = 1;
>> for (ffi = bun->ffList; ffi != NULL; ffi = ffi->next)
>> {
>> struct ffAli *ff = ffi->ff;
>> struct trans3 *t3List = NULL;
>> int score;
>> if (t3Hash != NULL)
>> t3List = hashMustFindVal(t3Hash, tSeq->name);
>> score = scoreAli(ff, bun->isProt, stringency, tSeq, t3List);
>> if (score>= minMatch)
>> {
>> out->out(chromName, chromSize, chromOffset, ff, tSeq, t3Hash, qSeq,
>> qIsRc, tIsRc, stringency, minMatch, out);
>> }
>> }
>> }
>>
>> See the two lines leading with "-" ?
>> They were deleted. They seemed to be
>> unneeded and causing unexpected behavior
>> to users.
>
> Hi Galt,
>
> Where to do get the blat version that you have fixed?
>
>> Unfortunately, Jim Kent's official release
>> seems to date back to 2007, but you could
>> get the source and compile it.
>>
>> Any blat version after 34x3 should have the fix.
>>
>> With the newer version, the cutoff works more
>> as you would expect. And for your example
>> of a 25bp stretch of dna with one mismatch,
>> your score would be +24 for the matches and
>> -1 for the 1 mismatch, thus score=24-1==23.
>>
>> And thus if you use minScore of 23 or lower
>> you can see the output psl record.
>> -minScore=23
>>
>> As we mentioned before,
>> you can just set minScore to zero and
>> then filter the psl output
>> with other tools afterwards.
>>
>> -Galt
>>
>> Ar 4/27/2010 3:35 PM, scríobh Peng Yu:
>>>
>>> Hi Galt,
>>>
>>> Here is the command that I use. You mentioned "Generally people don't
>>> much bother with using BLAT's own commandline options for minScore,
>>> etc." But I want to understand what minScore is and when it can be
>>> ignored. Would you please let me know?
>>>
>>>
>>> $ blat -t=dna -q=dna -stepSize=5 -minScore=25 -maxGap=0 -noHead \
>>> database.fasta \
>>> query.fasta \
>>> query.psl
>>> $ cat query.fasta
>>>>
>>>> test_sequence
>>>
>>> cttgcaccggaaagtctgctccaga
>>> $ cat database.fasta
>>>>
>>>> database_chr1
>>>
>>> ctagcaccggaaagtctgctccaga
>>> $ cat query.psl
>>> 24 1 0 0 0 0 0 0 +
>>> test_sequence 25 0 25 database_chr1 25 0 25
>>> 1 25, 0, 0,
>>>
>>>
>>>
>>> On Mon, Apr 26, 2010 at 4:30 PM, Jennifer Jackson<[email protected]>
>>> wrote:
>>>>
>>>> Hello Peng,
>>>>
>>>> Very sorry, your reply went to the genome mailing list only, not to your
>>>> email address as well. Our apologies.
>>>>
>>>> Here is the posting:
>>>> https://lists.soe.ucsc.edu/pipermail/genome/2010-April/022012.html
>>>>
>>>> Jennifer
>>>>
>>>> ---------------------------------
>>>> Jennifer Jackson
>>>> UCSC Genome Informatics Group
>>>> http://genome.ucsc.edu/
>>>>
>>>> On 4/24/10 12:09 PM, Peng Yu wrote:
>>>>>
>>>>> Could somebody answer me the following question?
>>>>>
>>>>> On Wed, Apr 21, 2010 at 2:48 PM, Peng Yu<[email protected]> wrote:
>>>>>>
>>>>>> I'm wondering what "some sort of gap penalty" refers to. Also I query
>>>>>> 25bp sequence using the default, BLAT still gives the result. By
>>>>>> definition 25bp sequence should at most have a score of 25, which is
>>>>>> less than 30. Why the query still returns the the result?
>>>>>>
>>>>>> -minScore=N sets minimum score. This is the matches minus the
>>>>>> mismatches minus some sort of gap penalty. Default is 30
>>>>>>
>>>>>>
>>>>>> --
>>>>>> Regards,
>>>>>> Peng
>>>>>>
>>>>>
>>>>>
>>>>>
>>>>
>>>
>>>
>>>
>>
>>
>
>
>
_______________________________________________
Genome maillist - [email protected]
https://lists.soe.ucsc.edu/mailman/listinfo/genome
