Hello, I am designing a PCR assay that amplifies a CNV at the LPA gene. My CNV of interest is repeated 6 times in the reference sequence. However, my primers for the sequence only yielded 5 hits from in silico PCR. I blasted the sequence of the hits against the repeat that failed to "amplify" (in silico) and found that the sequences corresponding to the primer binding sites are 100% identical (although there do appear to be two deletions within the PCR product region). Why is in silico PCR not finding each repeat?
My primers: (AGATGGAGCCCAAGC; ACGACTGGAGGAGACTTCTAT) The coordinates of my gene: chr6:160872505-161007397 The coordinates of the 6 repeats: chr6:160953952 160958298 chr6:160959504 160963844 chr6:160965050 160969388 chr6:160970594 160974934 chr6:160976143 160980481 chr6:160981687 160986028 Thanks! Philip Haycock _______________________________________________ Genome maillist - [email protected] https://lists.soe.ucsc.edu/mailman/listinfo/genome
