Hello,

I am designing a PCR assay that amplifies a CNV at the LPA gene. My CNV of
interest is repeated 6 times in the reference sequence. However, my primers
for the sequence only yielded 5 hits from in silico PCR. I blasted the
sequence of the hits against the repeat that failed to "amplify" (in silico)
and found that the sequences corresponding to the primer binding sites are
100% identical (although there do appear to be two deletions within the PCR
product region). Why is in silico PCR not finding each repeat?

My primers: (AGATGGAGCCCAAGC; ACGACTGGAGGAGACTTCTAT)
The coordinates of my gene: chr6:160872505-161007397
The coordinates of the 6 repeats:
chr6:160953952 160958298
chr6:160959504 160963844
chr6:160965050 160969388
chr6:160970594 160974934
chr6:160976143 160980481
chr6:160981687 160986028


Thanks!

Philip Haycock
_______________________________________________
Genome maillist  -  [email protected]
https://lists.soe.ucsc.edu/mailman/listinfo/genome

Reply via email to