Hi Philip,
We tested your primers at UCSC using hg18 and hg19 and also found that
only 5 regions were identified with the isPcr utility with default
parameters ("PCR" web tool).
Increasing the max product size would identify more matches (changed
default 4000 to 6000), however the size of the additional products was
much longer than your original five and different than the lengths that
would result from the coordinates that you specify in your list. This is
likely not the solution.
The forward primer length is the minimum length that the utility can
find. A quick BLAT using the reverse primer and the UCSC web server is
able to find six hits, clustered to the same five regions as the isPcr
utility, plus one. It may simply be that the forward primer for the one
unidentified region cannot be identified with isPcr.
From the coordinates and other data, it seems that you are using the
human genome, but not the hg18 or hg19 human reference genome at UCSC.
The guess is that your alternate reference genome is in a mirror or that
you are possibly using the line command version of the utility with your
alternate reference genome.
If you did want to go further, then we would need to know more details
of your exact query. The genome, how the tool is used (mirror or line
command), and your exact parameters. But, even having us duplicate your
query may not resolve the missing region. It sounds like you did much of
this same analysis yourself and perhaps just want to confirm what you
found - that isPcr can only identify 5 out of 6.
Since you already know your regions, the forward primer is short, the
reverse primer does have six unique matches by BLAT, and your own
analysis has determined that all six regions complete can be found by
other methods, then the best advice is probably to just go with what you
know and not worry about the isPcr result.
We hope that this helps. Comments are welcomed!
Best regards,
Jen
UCSC Genome Browser Support
http://genome.ucsc.edu/contacts.html
[email protected] [email protected]
On 7/6/10 9:09 AM, Philip Haycock wrote:
> Hello,
>
> I am designing a PCR assay that amplifies a CNV at the LPA gene. My CNV of
> interest is repeated 6 times in the reference sequence. However, my primers
> for the sequence only yielded 5 hits from in silico PCR. I blasted the
> sequence of the hits against the repeat that failed to "amplify" (in silico)
> and found that the sequences corresponding to the primer binding sites are
> 100% identical (although there do appear to be two deletions within the PCR
> product region). Why is in silico PCR not finding each repeat?
>
> My primers: (AGATGGAGCCCAAGC; ACGACTGGAGGAGACTTCTAT)
> The coordinates of my gene: chr6:160872505-161007397
> The coordinates of the 6 repeats:
> chr6:160953952 160958298
> chr6:160959504 160963844
> chr6:160965050 160969388
> chr6:160970594 160974934
> chr6:160976143 160980481
> chr6:160981687 160986028
>
>
> Thanks!
>
> Philip Haycock
> _______________________________________________
> Genome maillist - [email protected]
> https://lists.soe.ucsc.edu/mailman/listinfo/genome
_______________________________________________
Genome maillist - [email protected]
https://lists.soe.ucsc.edu/mailman/listinfo/genome
