I try to map the following positions from mm8 to mm9 using liftOver: chr2:22766881-22766905. liftOver reports that this has been deleted in mm9. So I blat the sequence from that region (AATCCGTGCCAGAGCTACAGACGCT) in mm9 and get chr2:22766903-22766905. I think map this from mm9 to mm8 using liftOver and it returns my original query (chr2:22766881-22766905).
I would expect liftOver to be reciprocal, but this appears not to be the case. Is there a reason for this, or is this a bug? Thanks John Didion _______________________________________________ Genome maillist - [email protected] https://lists.soe.ucsc.edu/mailman/listinfo/genome
