Correction, the mm9 position is chr2:22770754-22770778.

On Thu, 15 Jul 2010 16:29:02 -0400, jdidion <[email protected]> wrote:
> I try to map the following positions from mm8 to mm9 using liftOver:
> chr2:22766881-22766905. liftOver reports that this has been deleted in
mm9.
> So I blat the sequence from that region (AATCCGTGCCAGAGCTACAGACGCT) in
mm9
> and get chr2:22766903-22766905. I think map this from mm9 to mm8 using
> liftOver and it returns my original query (chr2:22766881-22766905).
> 
> I would expect liftOver to be reciprocal, but this appears not to be the
> case. Is there a reason for this, or is this a bug?
> 
> Thanks
> 
> John Didion
_______________________________________________
Genome maillist  -  [email protected]
https://lists.soe.ucsc.edu/mailman/listinfo/genome

Reply via email to