Correction, the mm9 position is chr2:22770754-22770778.
On Thu, 15 Jul 2010 16:29:02 -0400, jdidion <[email protected]> wrote: > I try to map the following positions from mm8 to mm9 using liftOver: > chr2:22766881-22766905. liftOver reports that this has been deleted in mm9. > So I blat the sequence from that region (AATCCGTGCCAGAGCTACAGACGCT) in mm9 > and get chr2:22766903-22766905. I think map this from mm9 to mm8 using > liftOver and it returns my original query (chr2:22766881-22766905). > > I would expect liftOver to be reciprocal, but this appears not to be the > case. Is there a reason for this, or is this a bug? > > Thanks > > John Didion _______________________________________________ Genome maillist - [email protected] https://lists.soe.ucsc.edu/mailman/listinfo/genome
