Dear Jen, I'm sorry for the late reply. I was away to participate in a serial workshop....The problem is indeed still persist:I think It's a problem for Mycobacterium tuberculosis H37Rv genome only (http://archaea.ucsc.edu/cgi-bin/hgBlat) as I tried out for other genomes, it seems to be Ok....For example:
>Contig_75 CTTCCCAGGTTGAATCAGTATCCCGCGATAGGAGGTGAGCAATCGACATCTTGCTCCGGCGGGCAGCCTGCGGCGGTAACTTCTCCAACCGCTCCCACCCCGTCGGCGCGTCTCCCCGAA Send this contig for blat targetting the Mycobacterium tuberculosis H37Rv genome,The following message pop out: Error(s):Connection refused Couldn't connect to kand.cse.ucsc.edu 20962Connection refused Sorry, the BLAT/iPCR server seems to be down. Please try again later. Could you or your colleague kindly look into this matter? Thanks a lot.... Hoe Chee HockPhD StudentMolecular Infectious Disease Lab, Infectious Disease Cluster, AMDI 22-1,Persiran Seksyen 4/9, Bandar Putra Bertam, 13200 Kepala Batas, Penang. Contact (M): +60125579013 > Date: Mon, 2 Aug 2010 11:26:55 -0700 > From: [email protected] > To: [email protected] > CC: [email protected] > Subject: Re: [Genome] BLAT server down > > Hello Hoe, > > Are you still experiencing this problem? > > The BLAT server is functioning at the main UCSC site > http://genome.ucsc.edu/cgi-bin/hgBlat. > > Are you perhaps using a mirror? If so, contacting the host would be the > best route for a fix. > > If the problem is persistent at UCSC, would you be be able to share an > example query sequence (small, please, pasted into the reply), target > database name, and any parameters set that deviate from the defaults? In > some rare cases a single genome can have problems and this would help us > to correct. > > Thank you, > > Jen > UCSC Genome Browser Support > > On 7/30/10 7:25 PM, Hoe Chee Hock wrote: > > > > Dear Sir/ Madam, > > Good day. I would like to inform you that the BLAT server seems to be > > down....Please kindly look into this matter and rectify it as soon as > > possible.Your kindness in this matter is highly appreciated...Thanks > > > > Hoe > > > > > > > > _______________________________________________ > > Genome maillist - [email protected] > > https://lists.soe.ucsc.edu/mailman/listinfo/genome _______________________________________________ Genome maillist - [email protected] https://lists.soe.ucsc.edu/mailman/listinfo/genome
