Dear Jen,
I'm sorry for the late reply. I was away to participate in a serial 
workshop....The problem is indeed still persist:I think It's a problem for 
Mycobacterium tuberculosis H37Rv genome only 
(http://archaea.ucsc.edu/cgi-bin/hgBlat)  as I tried out for other genomes, it 
seems  to be Ok....For example:

>Contig_75 

CTTCCCAGGTTGAATCAGTATCCCGCGATAGGAGGTGAGCAATCGACATCTTGCTCCGGCGGGCAGCCTGCGGCGGTAACTTCTCCAACCGCTCCCACCCCGTCGGCGCGTCTCCCCGAA
Send this contig for blat targetting the Mycobacterium tuberculosis H37Rv 
genome,The following message pop out:
Error(s):Connection refused
Couldn't connect to kand.cse.ucsc.edu 20962Connection refused
Sorry, the BLAT/iPCR server seems to be down. Please try again later.
Could you or your colleague kindly look into this matter? Thanks a lot....





Hoe Chee HockPhD StudentMolecular Infectious Disease Lab, 
Infectious Disease Cluster, AMDI
22-1,Persiran Seksyen 4/9,
Bandar Putra Bertam,
13200 Kepala Batas, Penang.
Contact (M): +60125579013




> Date: Mon, 2 Aug 2010 11:26:55 -0700
> From: [email protected]
> To: [email protected]
> CC: [email protected]
> Subject: Re: [Genome] BLAT server down
> 
> Hello Hoe,
> 
> Are you still experiencing this problem?
> 
> The BLAT server is functioning at the main UCSC site 
> http://genome.ucsc.edu/cgi-bin/hgBlat.
> 
> Are you perhaps using a mirror? If so, contacting the host would be the 
> best route for a fix.
> 
> If the problem is persistent at UCSC, would you be be able to share an 
> example query sequence (small, please, pasted into the reply), target 
> database name, and any parameters set that deviate from the defaults? In 
> some rare cases a single genome can have problems and this would help us 
> to correct.
> 
> Thank you,
> 
> Jen
> UCSC Genome Browser Support
> 
> On 7/30/10 7:25 PM, Hoe Chee Hock wrote:
> >
> > Dear Sir/ Madam,
> > Good day. I would like to inform you that the BLAT server seems to be 
> > down....Please kindly look into this matter and rectify it as soon as 
> > possible.Your kindness in this matter is highly appreciated...Thanks
> >
> > Hoe
> >
> >
> >                                     
> > _______________________________________________
> > Genome maillist  -  [email protected]
> > https://lists.soe.ucsc.edu/mailman/listinfo/genome
                                          
_______________________________________________
Genome maillist  -  [email protected]
https://lists.soe.ucsc.edu/mailman/listinfo/genome

Reply via email to