Hello again, This can be duplicated here and we are working with the Lowe lab to have this corrected in the microbial browser. Once this is fixed we'll send you an update.
Thank you for letting us know about the problem! Jen UCSC Genome Browser Support On 8/13/10 7:58 PM, Hoe Chee Hock wrote: > Dear Jen, > > I'm sorry for the late reply. I was away to participate in a serial > workshop.... > The problem is indeed still persist: > I think It's a problem for *Mycobacterium tuberculosis H37Rv genome > only* (http://archaea.ucsc.edu/cgi-bin/hgBlat) as I tried out for other > genomes, it seems to be Ok.... > For example: > > >Contig_75 > > CTTCCCAGGTTGAATCAGTATCCCGCGATAGGAGGTGAGCAATCGACATCTTGCTCCGGCGGGCAGCCTGCGGCGGTAACTTCTCCAACCGCTCCCACCCCGTCGGCGCGTCTCCCCGAA > > > Send this contig for blat targetting the Mycobacterium tuberculosis > H37Rv genome, > > The following message pop out: > > > *Error(s):* > > * Connection refused > Couldn't connect to kand.cse.ucsc.edu 20962 > * Connection refused > Sorry, the BLAT/iPCR server seems to be down. Please try again later. > > > Could you or your colleague kindly look into this matter? Thanks a lot.... > > > *Hoe Chee Hock > **PhD Student > *Molecular Infectious Disease Lab, > Infectious Disease Cluster, AMDI > 22-1,Persiran Seksyen 4/9, > Bandar Putra Bertam, > 13200 Kepala Batas, Penang. > *Contact (M): +60125579013* > > > > > > Date: Mon, 2 Aug 2010 11:26:55 -0700 > > From: [email protected] > > To: [email protected] > > CC: [email protected] > > Subject: Re: [Genome] BLAT server down > > > > Hello Hoe, > > > > Are you still experiencing this problem? > > > > The BLAT server is functioning at the main UCSC site > > http://genome.ucsc.edu/cgi-bin/hgBlat. > > > > Are you perhaps using a mirror? If so, contacting the host would be the > > best route for a fix. > > > > If the problem is persistent at UCSC, would you be be able to share an > > example query sequence (small, please, pasted into the reply), target > > database name, and any parameters set that deviate from the defaults? In > > some rare cases a single genome can have problems and this would help us > > to correct. > > > > Thank you, > > > > Jen > > UCSC Genome Browser Support > > > > On 7/30/10 7:25 PM, Hoe Chee Hock wrote: > > > > > > Dear Sir/ Madam, > > > Good day. I would like to inform you that the BLAT server seems to > be down....Please kindly look into this matter and rectify it as soon as > possible.Your kindness in this matter is highly appreciated...Thanks > > > > > > Hoe > > > > > > > > > > > > _______________________________________________ > > > Genome maillist - [email protected] > > > https://lists.soe.ucsc.edu/mailman/listinfo/genome _______________________________________________ Genome maillist - [email protected] https://lists.soe.ucsc.edu/mailman/listinfo/genome
