Dear Prof. I want to know how many repeats of this sequence in Zebrafish: 5' acacccttgtgcctttatctcccat 3'. This sequence is beta-arrestin 1 morpholino. But it is too short to blat it. How can I do this? Thank you very much in advance.
-- Best regards, Jinyan Huang (ekeen) School of Life Sciences and Technology, 1302 Room Tongji University Siping Road 1239, Shanghai 200092 P.R. China Tel :0086-21-65981041 Msn: [EMAIL PROTECTED] eMail: [EMAIL PROTECTED] _______________________________________________ Genome maillist - [email protected] http://www.soe.ucsc.edu/mailman/listinfo/genome
