Hello Jinyan,

This sequence is actually long enough to blat. Blat will find perfect 
sequence matches of 25 bases, and sometimes find them down to 20 bases. 
In your query 21 of the 25 bases align to dm5 at 
chr4:39,278,984-39,279,004.

For sequences that are 20bp or shorter you can search in the "Short 
Match" track. We also have tracks that detail different types of repeats 
(Interrupted Rpts, Simple Repeats) in the Zebrafish browser if you are 
interested in repeats.

Hopefully this information was helpful and answers your question. If you 
have further questions or require clarification feel free to contact the 
mailing list at [EMAIL PROTECTED]

Regards,

Pauline Fujita
UCSC Genome Bioinformatics Group
http://genome.ucsc.edu

Jinyan Huang wrote:
> Dear Prof.
>
> I want to know how many repeats of this sequence in Zebrafish: 5'
> acacccttgtgcctttatctcccat 3'. This sequence is beta-arrestin 1
> morpholino. But it is too short to blat it.
> How can I do this?
> Thank you very much in advance.
>
>
>   

_______________________________________________
Genome maillist  -  [email protected]
http://www.soe.ucsc.edu/mailman/listinfo/genome

Reply via email to