Hello,
I hope you could help me with this.
I used BLAT with the following
>1
CCGGTAGTAGCAGGACTGCTCTCACTGCCATTGTTG
>2
ACCGGTAGTAGCAGGACTGCTCTCACTGCCATTGTT
>3
CAATGGCAGTGAGAGCAGTCCTGCTACTACCGGTGC
>4
AGTGCACCGGTAGTAGCAGGACTGCTCTCACTGCCA
>5
AGTGCACCGGTAGTAGCAGGACTGCTCTCCCTTCCT
>6
AGTGCACCGGTAGTAGCAGGACTGCTCTCACTGCCA
>7
GCAGTGAGAGCAGTCCTGCTACTACCGGTGCACTGT
The I copied the psl output (seeing below) to the "Past URLs or data" box at
the "Add custom Tracks" page.
36 0 0 0 0 0 0 0 - 1
36 0 36 chr1 247249719 7812494 7812530 1 36,
0, 7812494,
36 0 0 0 0 0 0 0 - 2
36 0 36 chr1 247249719 7812495 7812531 1 36,
0, 7812495,
36 0 0 0 0 0 0 0 + 3
36 0 36 chr1 247249719 7812497 7812533 1 36,
0, 7812497,
36 0 0 0 0 0 0 0 - 4
36 0 36 chr1 247249719 7812500 7812536 1 36,
0, 7812500,
29 0 0 0 0 0 0 0 - 5
36 0 29 chr1 247249719 7812507 7812536 1 29,
7, 7812507,
36 0 0 0 0 0 0 0 - 6
36 0 36 chr1 247249719 7812500 7812536 1 36,
0, 7812500,
36 0 0 0 0 0 0 0 + 7
36 0 36 chr1 247249719 7812502 7812538 1 36,
0, 7812502,
The result is the following
Couple of times I managed to get the same tracks under the heading "blat
result" and instead of the white arrows showing the direction of the
sequence, the boxes were black and the SNP was displayed on the black bar
representing the sequence, like this:
How do I get this last one consistently?
Thank you
__________________________________________
Nickolas Papadopoulos, Ph.D.
Associate Professor
Department of Oncology
Director of Translational Genetics
Ludwig Center for Cancer Genetics & Therapeutics
Sidney Kimmel Comprehensive Cancer Center
The Johns Hopkins Institutions
CRB1, Room 585
1650 Orleans Street
Baltimore, MD 21231
Phone: 410 955 8878
Fax: 410 955 0548
__________________________________________
_______________________________________________
Genome maillist - [email protected]
http://www.soe.ucsc.edu/mailman/listinfo/genome
