Hello, In extracting out orthologous sequences between human and mouse from the 17-way alignments I came across this alignment:
a score=1971219.000000 s hg18.chr5 161255235 226 + 180857866 TTTTTTCTTT---ACAGGAGTAACAACTGTGCTCACCATGACAACATTGAGCATCAGTGCCAGAAACTCCCTCCCTAAGGTGGCTTATG CAACAGCTATGGATTGGTTTATTGCCGTGTGCTATGCCTTTGTGTTCTCAGCTCTGATTGAGTTTGCCACAGTAAACTATTTCACTAAGAGAGGTTATGCATGGGATGGCAAAAGTGTGGTTCCAGA AAAGGTAA-A----TGC-T s mm8.chr11 79819585 226 - 121798632 TTCTCTCCTT---TTAGGAGTGACGACTGTTCTGACTATGACAACCTTGAGTATCAGTGCCAGAAATTCCCTCCCGAAGGTGGCTTATG CAACAGCTATGGACTGGTTTATTGCAGTATGCTATGCCTTTGTTTTCTCAGCTCTGATTGAGTTTGCCACAGTAAACTATTTCACCAAGAGAGGGTATGCGTGGGATGGCAAAAGCGTGGTTCCAGA AAAGGTAA-A----CAC-C i mm8.chr11 C 0 C 0 However, it appears that the mouse sequence is actually from this coordinate: chr11:41948901-41949116. There appears to be a high level of homology in the vicinity of these two regions on mouse chromosome 11. The 28-way alignments provide a similar mouse coordinate region to that found in the 17-way alignment. Could you please advise on what the problem might be? Thank-you. Debra _______________________________________________ Genome maillist - [email protected] http://www.soe.ucsc.edu/mailman/listinfo/genome
