Hello Debra, To calculate browser coordinates from our alignment files for alignments to the negative strand, you need to convert the numbers you see in the file. For alignments to the positive strand:
s hg18.chr5 161255235 226 + 180857866 You can simply read off the coordinates. Please see this previously answer mailing list question about this conversion: http://www.soe.ucsc.edu/pipermail/genome/2007-September/014617.html For the mouse entry in question: s mm8.chr11 79819585 226 - 121798632 Corresponds to: source: mm8.chr11 start: 79819585 size: 226 strand: - source size: 121798632 To convert these numbers to Genome Browser coordinates, first subtract the start from the source size: 121798632 - 79819585 = 41979047 This is the right-most coordinate displayed in the browser. To get the left-most coordinate, subtract 226 from this number: 41979047 - 226 = 41978821 This yields coordinates: chr11: 41978821-41979047 This corresponds roughly to the results I see when blatting your sequence against mm8: BLAT Search Results ACTIONS QUERY SCORE START END QSIZE IDENTITY CHRO STRAND START END SPAN --------------------------------------------------------------------------------------------------- browser <../cgi-bin/hgTracks?position=chr11:41978827-41979037&db=mm8&ss=../trash/hgSs/hgSs_genome_b2a_67f830.pslx+../trash/hgSs/hgSs_genome_b2a_67f830.fa&hgsid=120087193> details <../cgi-bin/hgc?o=41978826&g=htcUserAli&i=../trash/hgSs/hgSs_genome_b2a_67f830.pslx+..%2Ftrash%2FhgSs%2FhgSs_genome_b2a_67f830.fa+YourSeq&c=chr11&l=41978826&r=41979037&db=mm8&hgsid=120087193> YourSeq 211 1 211 211 100.0% 11 - 41978827 41979037 211 Hopefully this information was helpful and answers your question. If you have further questions or require clarification feel free to contact the mailing list at [email protected]. Regards, Pauline Fujita UCSC Genome Bioinformatics Group http://genome.ucsc.edu [email protected] wrote: > Hello, > > In extracting out orthologous sequences between human and mouse from the > 17-way alignments I came across this alignment: > > a score=1971219.000000 > s hg18.chr5 161255235 226 + 180857866 > TTTTTTCTTT---ACAGGAGTAACAACTGTGCTCACCATGACAACATTGAGCATCAGTGCCAGAAACTCCCTCCCTAAGGTGGCTTATG > CAACAGCTATGGATTGGTTTATTGCCGTGTGCTATGCCTTTGTGTTCTCAGCTCTGATTGAGTTTGCCACAGTAAACTATTTCACTAAGAGAGGTTATGCATGGGATGGCAAAAGTGTGGTTCCAGA > AAAGGTAA-A----TGC-T > s mm8.chr11 79819585 226 - 121798632 > TTCTCTCCTT---TTAGGAGTGACGACTGTTCTGACTATGACAACCTTGAGTATCAGTGCCAGAAATTCCCTCCCGAAGGTGGCTTATG > CAACAGCTATGGACTGGTTTATTGCAGTATGCTATGCCTTTGTTTTCTCAGCTCTGATTGAGTTTGCCACAGTAAACTATTTCACCAAGAGAGGGTATGCGTGGGATGGCAAAAGCGTGGTTCCAGA > AAAGGTAA-A----CAC-C > i mm8.chr11 C 0 C 0 > > However, it appears that the mouse sequence is actually from this > coordinate: chr11:41948901-41949116. There appears to be a high level of > homology in the vicinity of these two regions on mouse chromosome 11. The > 28-way alignments provide a similar mouse coordinate region to that found > in the 17-way alignment. Could you please advise on what the problem might > be? > > Thank-you. > Debra > > _______________________________________________ > Genome maillist - [email protected] > http://www.soe.ucsc.edu/mailman/listinfo/genome > _______________________________________________ Genome maillist - [email protected] http://www.soe.ucsc.edu/mailman/listinfo/genome
