Hi, Ji Wan Please try blat with -stepSize=5 -repMatch=2048 and let us know if that made a difference.
-Galt On Fri, 20 Mar 2009, ji wan wrote: > Hi There, > > I tried to use blat to align a set of short sequences. However, I can't get > a complete set of perfect matching results as your website provided. For > example , when I tried to search a sequence-- AAAAGCTGGGTTGAGAGGGCAAA, I can > only get one perfect match locally, however your web results give two. Can > you help me to find out what's the probelm? I used blat instead of your > client-server mode. For running parameters, which I got from a previous post > from the mailing list, I believe they are the same as yours. Thanks, > > Ji Wan > _______________________________________________ > Genome maillist - [email protected] > http://www.soe.ucsc.edu/mailman/listinfo/genome > _______________________________________________ Genome maillist - [email protected] http://www.soe.ucsc.edu/mailman/listinfo/genome
