Hi, Ji Wan

Please try blat with -stepSize=5 -repMatch=2048 and let us know
if that made a difference.

-Galt


On Fri, 20 Mar 2009, ji wan wrote:

> Hi There,
>
> I tried to use blat to align a set of short sequences. However, I can't get
> a complete set of perfect matching results as your website provided. For
> example , when I tried to search a sequence-- AAAAGCTGGGTTGAGAGGGCAAA, I can
> only get one perfect match locally, however your web results give two. Can
> you help me to find out what's the probelm? I used blat instead of your
> client-server mode. For running parameters, which I got from a previous post
> from the mailing list,  I believe they are the same as yours. Thanks,
>
> Ji Wan
> _______________________________________________
> Genome maillist  -  [email protected]
> http://www.soe.ucsc.edu/mailman/listinfo/genome
>
_______________________________________________
Genome maillist  -  [email protected]
http://www.soe.ucsc.edu/mailman/listinfo/genome

Reply via email to