Hi There, I tried to use blat to align a set of short sequences. However, I can't get a complete set of perfect matching results as your website provided. For example , when I tried to search a sequence-- AAAAGCTGGGTTGAGAGGGCAAA, I can only get one perfect match locally, however your web results give two. Can you help me to find out what's the probelm? I used blat instead of your client-server mode. For running parameters, which I got from a previous post from the mailing list, I believe they are the same as yours. Thanks,
Ji Wan _______________________________________________ Genome maillist - [email protected] http://www.soe.ucsc.edu/mailman/listinfo/genome
