Hi There,

I tried to use blat to align a set of short sequences. However, I can't get
a complete set of perfect matching results as your website provided. For
example , when I tried to search a sequence-- AAAAGCTGGGTTGAGAGGGCAAA, I can
only get one perfect match locally, however your web results give two. Can
you help me to find out what's the probelm? I used blat instead of your
client-server mode. For running parameters, which I got from a previous post
from the mailing list,  I believe they are the same as yours. Thanks,

Ji Wan
_______________________________________________
Genome maillist  -  [email protected]
http://www.soe.ucsc.edu/mailman/listinfo/genome

Reply via email to