Dear Sir, These two sequences are taken from UCSC,which are annonated as MADE1.
>MADE1_chr1_4815017-4815036 GTAGTTTTGCACCAACCTAA >MADE1_chr1_4815061-4815083 GGATTTTCCATTACTTTCAATGA But when I submitted to your RepeatMasker Web Server ( http://www.repeatmasker.org/cgi-bin/WEBRepeatMasker),it return as "No repetitive sequences were detected........." .Such as http://www.repeatmasker.org/tmp/f901d5fe65aca9d4562726a72efbd086.html. And why ? Also L2 was predicted by RepeatMasker as locate in chr7:21477117-21477393<http://genome.ucsc.edu/cgi-bin/hgTracks?hgsid=132277713&db=hg18&position=chr7%3A21477117-21477393>,but as predicted by RepeatMasker 3.27 then locate in chr7:21477203-21477393<http://genome.ucsc.edu/cgi-bin/hgTracks?hgsid=132277713&db=hg18&position=chr7%3A21477203-21477393>. So which is more reliable? Looking forward to your reply! Thank you! Best wishes. -- Yuan Zhidong Department of Biomedical Engineering State Key Laboratory of Bioelectronics (Chien-Shiung Wu Laboratory) Southeast University, Nanjing, 210096, China _______________________________________________ Genome maillist - [email protected] https://lists.soe.ucsc.edu/mailman/listinfo/genome
