Hello, For the first example, the sequence fragments are simply too short to be picked up by Repeat Masker. Try adding some of the flanking genomic sequence.
For the second example, the tracks were created at different times using a different version of Repeat Masker. We use the Repeat Masker tool as-is without modification. Source/Methods/Credits and updated date for any track is noted on the track details page. Any questions about content/algorithm changes are best directed to the author of the tool. http://www.repeatmasker.org Thank you, Jennifer Jackson UCSC Genome Bioinformatics Group zhidong yuan wrote: > Dear Sir, > > These two sequences are taken from UCSC,which are annonated as MADE1. > > >> MADE1_chr1_4815017-4815036 >> > GTAGTTTTGCACCAACCTAA > >> MADE1_chr1_4815061-4815083 >> > GGATTTTCCATTACTTTCAATGA > > But when I submitted to your RepeatMasker Web Server ( > http://www.repeatmasker.org/cgi-bin/WEBRepeatMasker),it return as "No > repetitive sequences were detected........." .Such as > http://www.repeatmasker.org/tmp/f901d5fe65aca9d4562726a72efbd086.html. And > why ? > > Also L2 was predicted by RepeatMasker as locate in > chr7:21477117-21477393<http://genome.ucsc.edu/cgi-bin/hgTracks?hgsid=132277713&db=hg18&position=chr7%3A21477117-21477393>,but > as predicted by RepeatMasker 3.27 then locate in > chr7:21477203-21477393<http://genome.ucsc.edu/cgi-bin/hgTracks?hgsid=132277713&db=hg18&position=chr7%3A21477203-21477393>. > So which is more reliable? > > Looking forward to your reply! Thank you! > > Best wishes. > _______________________________________________ Genome maillist - [email protected] https://lists.soe.ucsc.edu/mailman/listinfo/genome
