Hello, You have extracted the component chromosome fragments from the Assembly track. Scroll/search in your browser/text output by ">" to find them all.
A better method is to use the "Get DNA" Tool for a single, genomic sequence in fasta format. To do this: 1) go to Assembly browser for mm9 2) enter the position and submit 3) I turned on the Assembly & Gap tracks for a quick look. There is a complete tiling path of fragments for this region and no gaps. Notice how the first contig is "AL806510.12",... the entire set was in your original output (when I duplicated your steps). You can skip this part for your actual query - this is just informative in case you do extract a region with gaps in the future and want to be able to view the source sequence. 4) click on "DNA" in the top blue navigation bar 5) change variables or leave as default to retrieve the same output as I have below: >mm9_dna range=chr4:45671438-47737119 5'pad=0 3'pad=0 strand=+ >repeatMasking=none GTCCAGTACTTTTCTTCCACCATGTGGGTTTTGGAGGTCACTCTGGTTGC CAAGCTTGGTAGCAAACACCCTTACTGGTAAGTTGTCTTAGCAGTCCCCT TGTAAAATTCATACCCTATGCATGAAGGATTGAGGTGGTATACTCTCTGC AGTAATTTGAGTAAGCGTGACCCCCATAGACTTATATATTTGAATGCCTA GGGAGTGGAACTGTTTGAAAGTATTAGAAAGATTAGGAGATGTGGCCTTT ..... more sequence ..... Thanks, Jennifer Jackson UCSC Genome Bioinformatics Group ps. Your message was bounced from the mailing list originally because of the attachment. Now, the graphic was very useful, but next time perhaps just list the steps to duplicate your query. Or send an email first asking the question stating that you wish to send a graphic and we can arrange for you to send one directly to our mailing list support person. Subject: get genomic sequence from table browser From: Yueming Ding <[email protected]> Date: Fri, 29 May 2009 15:16:57 -0400 To: "[email protected]" <[email protected]> Hi, I am trying to get mouse genomic sequences from Table Browser for a region (chr4:45671438-47737119). I used the following options (see enclosed screen shot). But the output sequence I got is chr4:45604984-45698070: >mm9_gold_AL806510.12 range=chr4:45604984-45698070 5'pad=0 3'pad=0 strand=+ repeatMasking=none CCAGCCATTCTGCCTCCAACAATGGGGCTGGAAGGGCCCTCTTCACGCTC …… Could you please tell me what I did is wrong? Thanks, Yueming Ding The Jackson Laboratory _______________________________________________ Genome maillist - [email protected] https://lists.soe.ucsc.edu/mailman/listinfo/genome
