Good Afternoon Christian: Your surmise is correct, these two areas are related in that they are duplications in the genome. You can see this in the track:
Segmental Dups - Duplications of >1000 Bases of Non-RepeatMasked Sequence Turn on that track and view the entire region: chr13:52,800,000-53,150,000 Note the large item named: chr13:53076392 on the left, and the other large item named: chr13:52783848 on the right. Almost 100,000 bases close to identical in the two locations. --Hiram ----- Original Message ----- From: "Christian N. Paxton" <[email protected]> To: [email protected] Sent: Tuesday, December 28, 2010 10:24:38 AM Subject: [Genome] multiple amplicon hits using in-silico PCR I am trying to identify potential PCR products on Chromosome 13 using your in-silico PCR function. I have one particular region where I have analyzed mulitple primers and in every case I have gotten back two potential PCR products, always approximately 30bp difference. At first I thought it was two possible amplicons resulting from variable sizes of the region which has short tandem repeats within it, but I noticed that the amplicons are on opposite strands of the DNA and appear to be from different regions of the chromosome (see attached image for an example). I was just wondering, is that region somehow duplicated within the database? The last set of primers analyzed are: Forward: 63.0 C atcacctaaggaggagggaaagg Reverse: 58.0 C gtaattgtttttatgtgggtaggatt I would appreciate any assistance you have to offer. Thank you. Christian Paxton R&D Specialist ARUP Laboratories 500 Chipeta Way Salt Lake City, 84132 _______________________________________________ Genome maillist - [email protected] https://lists.soe.ucsc.edu/mailman/listinfo/genome
