Good Afternoon Christian:

Your surmise is correct, these two areas are related in that they
are duplications in the genome.  You can see this in the track:

Segmental Dups - Duplications of >1000 Bases of Non-RepeatMasked Sequence 

Turn on that track and view the entire region: chr13:52,800,000-53,150,000
Note the large item named: chr13:53076392 on the left, and
the other large item named: chr13:52783848 on the right.

Almost 100,000 bases close to identical in the two locations.

--Hiram

----- Original Message -----
From: "Christian N. Paxton" <[email protected]>
To: [email protected]
Sent: Tuesday, December 28, 2010 10:24:38 AM
Subject: [Genome] multiple amplicon hits using in-silico PCR

I am trying to identify potential PCR products on Chromosome 13 using
your in-silico PCR function. I have one particular region where I have
analyzed mulitple primers and in every case I have gotten back two
potential PCR products, always approximately 30bp difference. At first I
thought it was two possible amplicons resulting from variable sizes of
the region which has short tandem repeats within it, but I noticed that
the amplicons are on opposite strands of the DNA and appear to be from
different regions of the chromosome (see attached image for an example).
I was just wondering, is that region somehow duplicated within the
database? The last set of primers analyzed are:

 

Forward: 63.0 C atcacctaaggaggagggaaagg
Reverse: 58.0 C gtaattgtttttatgtgggtaggatt

 

I would appreciate any assistance you have to offer. Thank you.

 

Christian Paxton
R&D Specialist
ARUP Laboratories
500 Chipeta Way
Salt Lake City, 84132
_______________________________________________
Genome maillist  -  [email protected]
https://lists.soe.ucsc.edu/mailman/listinfo/genome

Reply via email to