I am trying to identify potential PCR products on Chromosome 13 using
your in-silico PCR function. I have one particular region where I have
analyzed mulitple primers and in every case I have gotten back two
potential PCR products, always approximately 30bp difference. At first I
thought it was two possible amplicons resulting from variable sizes of
the region which has short tandem repeats within it, but I noticed that
the amplicons are on opposite strands of the DNA and appear to be from
different regions of the chromosome (see attached image for an example).
I was just wondering, is that region somehow duplicated within the
database? The last set of primers analyzed are:
Forward: 63.0 C atcacctaaggaggagggaaagg
Reverse: 58.0 C gtaattgtttttatgtgggtaggatt
I would appreciate any assistance you have to offer. Thank you.
Christian Paxton
R&D Specialist
ARUP Laboratories
500 Chipeta Way
Salt Lake City, 84132
- ------------------------------------------------------------------
The information transmitted by this e-mail and any included
attachments are from ARUP Laboratories and are intended only for the
recipient. The information contained in this message is confidential
and may constitute inside or non-public information under
international, federal, or state securities laws, or protected health
information and is intended only for the use of the recipient.
Unauthorized forwarding, printing, copying, distributing, or use of
such information is strictly prohibited and may be unlawful. If you
are not the intended recipient, please promptly delete this e-mail
and notify the sender of the delivery error or you may call ARUP
Laboratories Compliance Hot Line in Salt Lake City, Utah USA at (+1
(800) 522-2787 ext. 2100
_______________________________________________
Genome maillist - [email protected]
https://lists.soe.ucsc.edu/mailman/listinfo/genome
