To Whom It May Concern, How do the BLAT and Self-Chain algorithms differ? The reason I ask is shown below. In trying to look at differences among the MHC haplotypes, I did a BLAT search on the following sequence:
>seq1 ACAGACCCCAGCTTTACAAGGACCCCAGCTCCTTAACACAGATCCCAGCTCCGAGGAAACTCGTCCCCCCCACGTTAATCCTGACCGACTTTGCCACATG BLAT Search Results ACTIONS QUERY SCORE START END QSIZE IDENTITY CHRO STRAND START END SPAN --------------------------------------------------------------------------------------------------- browser<http://genome.ucsc.edu/cgi-bin/hgTracks?position=chr6_mann_hap4:2454805-2454904&db=hg19&ss=../trash/hgSs/hgSs_genome_a22_b1d170.pslx+../trash/hgSs/hgSs_genome_a22_b1d170.fa&hgsid=185182739> details<http://genome.ucsc.edu/cgi-bin/hgc?o=2454804&g=htcUserAli&i=../trash/hgSs/hgSs_genome_a22_b1d170.pslx+..%2Ftrash%2FhgSs%2FhgSs_genome_a22_b1d170.fa+YourSeq&c=chr6_mann_hap4&l=2454804&r=2454904&db=hg19&hgsid=185182739> YourSeq 100 1 100 100 100.0% 6_mann_hap4 + 2454805 2454904 100 browser<http://genome.ucsc.edu/cgi-bin/hgTracks?position=chr6_dbb_hap3:2403575-2403674&db=hg19&ss=../trash/hgSs/hgSs_genome_a22_b1d170.pslx+../trash/hgSs/hgSs_genome_a22_b1d170.fa&hgsid=185182739> details<http://genome.ucsc.edu/cgi-bin/hgc?o=2403574&g=htcUserAli&i=../trash/hgSs/hgSs_genome_a22_b1d170.pslx+..%2Ftrash%2FhgSs%2FhgSs_genome_a22_b1d170.fa+YourSeq&c=chr6_dbb_hap3&l=2403574&r=2403674&db=hg19&hgsid=185182739> YourSeq 100 1 100 100 100.0% 6_dbb_hap3 + 2403575 2403674 100 browser<http://genome.ucsc.edu/cgi-bin/hgTracks?position=chr6_cox_hap2:2621159-2621258&db=hg19&ss=../trash/hgSs/hgSs_genome_a22_b1d170.pslx+../trash/hgSs/hgSs_genome_a22_b1d170.fa&hgsid=185182739> details<http://genome.ucsc.edu/cgi-bin/hgc?o=2621158&g=htcUserAli&i=../trash/hgSs/hgSs_genome_a22_b1d170.pslx+..%2Ftrash%2FhgSs%2FhgSs_genome_a22_b1d170.fa+YourSeq&c=chr6_cox_hap2&l=2621158&r=2621258&db=hg19&hgsid=185182739> YourSeq 100 1 100 100 100.0% 6_cox_hap2 + 2621159 2621258 100 browser<http://genome.ucsc.edu/cgi-bin/hgTracks?position=chr6:31106437-31106536&db=hg19&ss=../trash/hgSs/hgSs_genome_a22_b1d170.pslx+../trash/hgSs/hgSs_genome_a22_b1d170.fa&hgsid=185182739> details<http://genome.ucsc.edu/cgi-bin/hgc?o=31106436&g=htcUserAli&i=../trash/hgSs/hgSs_genome_a22_b1d170.pslx+..%2Ftrash%2FhgSs%2FhgSs_genome_a22_b1d170.fa+YourSeq&c=chr6&l=31106436&r=31106536&db=hg19&hgsid=185182739> YourSeq 100 1 100 100 100.0% 6 + 31106437 31106536 100 browser<http://genome.ucsc.edu/cgi-bin/hgTracks?position=chr6_mcf_hap5:2488382-2488481&db=hg19&ss=../trash/hgSs/hgSs_genome_a22_b1d170.pslx+../trash/hgSs/hgSs_genome_a22_b1d170.fa&hgsid=185182739> details<http://genome.ucsc.edu/cgi-bin/hgc?o=2488381&g=htcUserAli&i=../trash/hgSs/hgSs_genome_a22_b1d170.pslx+..%2Ftrash%2FhgSs%2FhgSs_genome_a22_b1d170.fa+YourSeq&c=chr6_mcf_hap5&l=2488381&r=2488481&db=hg19&hgsid=185182739> YourSeq 98 1 100 100 99.0% 6_mcf_hap5 + 2488382 2488481 100 browser<http://genome.ucsc.edu/cgi-bin/hgTracks?position=chr6_qbl_hap6:2402283-2402381&db=hg19&ss=../trash/hgSs/hgSs_genome_a22_b1d170.pslx+../trash/hgSs/hgSs_genome_a22_b1d170.fa&hgsid=185182739> details<http://genome.ucsc.edu/cgi-bin/hgc?o=2402282&g=htcUserAli&i=../trash/hgSs/hgSs_genome_a22_b1d170.pslx+..%2Ftrash%2FhgSs%2FhgSs_genome_a22_b1d170.fa+YourSeq&c=chr6_qbl_hap6&l=2402282&r=2402381&db=hg19&hgsid=185182739> YourSeq 96 1 100 100 96.0% 6_qbl_hap6 + 2402283 2402381 99 browser<http://genome.ucsc.edu/cgi-bin/hgTracks?position=chr17:8526697-8526717&db=hg19&ss=../trash/hgSs/hgSs_genome_a22_b1d170.pslx+../trash/hgSs/hgSs_genome_a22_b1d170.fa&hgsid=185182739> details<http://genome.ucsc.edu/cgi-bin/hgc?o=8526696&g=htcUserAli&i=../trash/hgSs/hgSs_genome_a22_b1d170.pslx+..%2Ftrash%2FhgSs%2FhgSs_genome_a22_b1d170.fa+YourSeq&c=chr17&l=8526696&r=8526717&db=hg19&hgsid=185182739> YourSeq 21 22 42 100 100.0% 17 - 8526697 8526717 21 The MANN (6_mann_hap4) result shows a perfect alignment. The QBL (6_qbl_hap6) result shows one polymorphism and one insertion. Next, I did a BLAT on a subset of this sequence that includes the polymorphism and insertion sites: >seq2 CCGAGGAAACTCGTCCCCCCCGTTAATCCTGACCGACTT BLAT Search Results ACTIONS QUERY SCORE START END QSIZE IDENTITY CHRO STRAND START END SPAN --------------------------------------------------------------------------------------------------- browser<http://genome.ucsc.edu/cgi-bin/hgTracks?position=chr6_mann_hap4:2454855-2454895&db=hg19&ss=../trash/hgSs/hgSs_genome_1458_b24af0.pslx+../trash/hgSs/hgSs_genome_1458_b24af0.fa&hgsid=185185025> details<http://genome.ucsc.edu/cgi-bin/hgc?o=2454854&g=htcUserAli&i=../trash/hgSs/hgSs_genome_1458_b24af0.pslx+..%2Ftrash%2FhgSs%2FhgSs_genome_1458_b24af0.fa+YourSeq&c=chr6_mann_hap4&l=2454854&r=2454895&db=hg19&hgsid=185185025> YourSeq 38 1 39 39 100.0% 6_mann_hap4 + 2454855 2454895 41 browser<http://genome.ucsc.edu/cgi-bin/hgTracks?position=chr6_dbb_hap3:2403625-2403665&db=hg19&ss=../trash/hgSs/hgSs_genome_1458_b24af0.pslx+../trash/hgSs/hgSs_genome_1458_b24af0.fa&hgsid=185185025> details<http://genome.ucsc.edu/cgi-bin/hgc?o=2403624&g=htcUserAli&i=../trash/hgSs/hgSs_genome_1458_b24af0.pslx+..%2Ftrash%2FhgSs%2FhgSs_genome_1458_b24af0.fa+YourSeq&c=chr6_dbb_hap3&l=2403624&r=2403665&db=hg19&hgsid=185185025> YourSeq 38 1 39 39 100.0% 6_dbb_hap3 + 2403625 2403665 41 browser<http://genome.ucsc.edu/cgi-bin/hgTracks?position=chr6_cox_hap2:2621209-2621249&db=hg19&ss=../trash/hgSs/hgSs_genome_1458_b24af0.pslx+../trash/hgSs/hgSs_genome_1458_b24af0.fa&hgsid=185185025> details<http://genome.ucsc.edu/cgi-bin/hgc?o=2621208&g=htcUserAli&i=../trash/hgSs/hgSs_genome_1458_b24af0.pslx+..%2Ftrash%2FhgSs%2FhgSs_genome_1458_b24af0.fa+YourSeq&c=chr6_cox_hap2&l=2621208&r=2621249&db=hg19&hgsid=185185025> YourSeq 38 1 39 39 100.0% 6_cox_hap2 + 2621209 2621249 41 browser<http://genome.ucsc.edu/cgi-bin/hgTracks?position=chr6:31106487-31106527&db=hg19&ss=../trash/hgSs/hgSs_genome_1458_b24af0.pslx+../trash/hgSs/hgSs_genome_1458_b24af0.fa&hgsid=185185025> details<http://genome.ucsc.edu/cgi-bin/hgc?o=31106486&g=htcUserAli&i=../trash/hgSs/hgSs_genome_1458_b24af0.pslx+..%2Ftrash%2FhgSs%2FhgSs_genome_1458_b24af0.fa+YourSeq&c=chr6&l=31106486&r=31106527&db=hg19&hgsid=185185025> YourSeq 38 1 39 39 100.0% 6 + 31106487 31106527 41 browser<http://genome.ucsc.edu/cgi-bin/hgTracks?position=chr6_qbl_hap6:2402333-2402372&db=hg19&ss=../trash/hgSs/hgSs_genome_1458_b24af0.pslx+../trash/hgSs/hgSs_genome_1458_b24af0.fa&hgsid=185185025> details<http://genome.ucsc.edu/cgi-bin/hgc?o=2402332&g=htcUserAli&i=../trash/hgSs/hgSs_genome_1458_b24af0.pslx+..%2Ftrash%2FhgSs%2FhgSs_genome_1458_b24af0.fa+YourSeq&c=chr6_qbl_hap6&l=2402332&r=2402372&db=hg19&hgsid=185185025> YourSeq 36 1 39 39 97.5% 6_qbl_hap6 + 2402333 2402372 40 browser<http://genome.ucsc.edu/cgi-bin/hgTracks?position=chr6_mcf_hap5:2488432-2488472&db=hg19&ss=../trash/hgSs/hgSs_genome_1458_b24af0.pslx+../trash/hgSs/hgSs_genome_1458_b24af0.fa&hgsid=185185025> details<http://genome.ucsc.edu/cgi-bin/hgc?o=2488431&g=htcUserAli&i=../trash/hgSs/hgSs_genome_1458_b24af0.pslx+..%2Ftrash%2FhgSs%2FhgSs_genome_1458_b24af0.fa+YourSeq&c=chr6_mcf_hap5&l=2488431&r=2488472&db=hg19&hgsid=185185025> YourSeq 34 1 39 39 94.9% 6_mcf_hap5 + 2488432 2488472 41 This time: The MANN result shows me a deletion of AC. The QBL result shows me that the polymorphism is present, but that there is a deletion rather than an insertion 8 bp away from the polymorphism site. Furthermore, the Self-Chain alignment within the MANN result shows that the QBL has a different base deleted than the one shown in the QBL result. Why the discrepancies? Sincerely, Hannah Cheung, PhD Postdoctoral Associate Plon Lab 1102 Bates Ave Rm.1200.18 Texas Children's Hospital Houston, TX 77030 _______________________________________________ Genome maillist - [email protected] https://lists.soe.ucsc.edu/mailman/listinfo/genome
