We have recently biochemically characterized two Drosophila proteins and an snRNA and propose the following name changes based on their function:
CG3508 should be called HEXIM and is the homologue of HEXIM1 and HEXIM2 in humans CG42569 should be called LARP7 and it the homologue to LARP7 in humans Also the following RNA is 7SK snRNA (the gene needs to be named according to snRNA gene nomenclature): GGAAGUGUAUUCUGUGAUUGUUCUGUACAUUGAUCGAUAUUCAGGUAACUGCAUCUGCUUAUCAGAUCUGUU CAGAGCCGACCCUCCGUCACACCUUUGUGUUUCCCAGUAAUUCUGCCUGGCGUUGCCGUGGCUCCUCGUUCG GAUCGGCUUUCCGCUGCCUUCCACUGGAUGACGACGGGUUAUCCGGCGGUCGACGCACGGUCAUGCACCCCC GAUCCGUCGCCCCCACCACCCCGCGGAUUCUGGUCUCGACCGGAAGCCGUAUUGGGCGGGGACGGGCGGCGG UCCGGUGCUGAAGCCGGCGACAGUUGCCCGAGUCAGCCACUUUCAAAAUUUGUUGGUUAAGUAACUUAGUAG CUUAGCUUCGGAUUUUCGUAACAAAUUUGCUGUUCAGAACACUUCCAUGUACGCGGCAUUGCCGAGCAAUUU GCCCAUUCUUUU Publication: The Drosophila 7SK snRNP and the essential role of dHEXIM in development. Nguyen D<http://www.ncbi.nlm.nih.gov/pubmed?term=%22Nguyen%20D%22%5BAuthor%5D>, Krueger BJ<http://www.ncbi.nlm.nih.gov/pubmed?term=%22Krueger%20BJ%22%5BAuthor%5D>, Sedore SC<http://www.ncbi.nlm.nih.gov/pubmed?term=%22Sedore%20SC%22%5BAuthor%5D>, Brogie JE<http://www.ncbi.nlm.nih.gov/pubmed?term=%22Brogie%20JE%22%5BAuthor%5D>, Rogers JT<http://www.ncbi.nlm.nih.gov/pubmed?term=%22Rogers%20JT%22%5BAuthor%5D>, Rajendra TK<http://www.ncbi.nlm.nih.gov/pubmed?term=%22Rajendra%20TK%22%5BAuthor%5D>, Saunders A<http://www.ncbi.nlm.nih.gov/pubmed?term=%22Saunders%20A%22%5BAuthor%5D>, Matera AG<http://www.ncbi.nlm.nih.gov/pubmed?term=%22Matera%20AG%22%5BAuthor%5D>, Lis JT<http://www.ncbi.nlm.nih.gov/pubmed?term=%22Lis%20JT%22%5BAuthor%5D>, Uguen P<http://www.ncbi.nlm.nih.gov/pubmed?term=%22Uguen%20P%22%5BAuthor%5D>, Price DH<http://www.ncbi.nlm.nih.gov/pubmed?term=%22Price%20DH%22%5BAuthor%5D>. PMID:22379134 Regulation of the positive transcription elongation factor, P-TEFb, plays a major role in controlling mammalian transcription and this is accomplished in part by controlled release of P-TEFb from the 7SK snRNP that sequesters the kinase in an inactive state. We demonstrate here that a similar P-TEFb control system exists in Drosophila. We show that an RNA previously suggested to be a 7SK homolog is, in fact, associated with P-TEFb, through the action of a homolog of the human HEXIM1/2 proteins (dHEXIM). In addition, a Drosophila La related protein (now called dLARP7) is shown to be the functional homolog of human LARP7. The Drosophila 7SK snRNP (d7SK snRNP) responded to treatment of cells with P-TEFb inhibitors and to nuclease treatment of cell lysates by releasing P-TEFb. Supporting a critical role for the d7SK snRNP in Drosophila development, dLARP7 and dHEXIM were found to be ubiquitously expressed throughout embryos and tissues at all stages. Importantly, knockdown of dH! EXIM was embryonic lethal, and reduction of dHEXIM in specific tissues led to serious developmental defects. Our results suggest that regulation of P-TEFb by the d7SK snRNP is essential for the growth and differentiation of tissues required during Drosophila development. David H. Price Professor of Biochemistry University of Iowa 375 Newton Rd. Iowa City, IA 52242 (319) 335-7910 http://www.uiowa.edu/~pricelab/ _______________________________________________ Genome maillist - [email protected] https://lists.soe.ucsc.edu/mailman/listinfo/genome
