Hi David, Thanks for your email, however, we don't actually do curation here at UCSC. We suggest contacting FlyBase or RefSeq; you may need to work with them for these name changes.
Please contact us again at [email protected] if you have any further questions. --- Luvina Guruvadoo UCSC Genome Bioinformatics Group On 5/3/2012 4:05 PM, Price, David H wrote: > We have recently biochemically characterized two Drosophila proteins and an > snRNA and propose the following name changes based on their function: > > CG3508 should be called HEXIM and is the homologue of HEXIM1 and HEXIM2 in > humans > CG42569 should be called LARP7 and it the homologue to LARP7 in humans > Also the following RNA is 7SK snRNA (the gene needs to be named according to > snRNA gene nomenclature): > GGAAGUGUAUUCUGUGAUUGUUCUGUACAUUGAUCGAUAUUCAGGUAACUGCAUCUGCUUAUCAGAUCUGUU > CAGAGCCGACCCUCCGUCACACCUUUGUGUUUCCCAGUAAUUCUGCCUGGCGUUGCCGUGGCUCCUCGUUCG > GAUCGGCUUUCCGCUGCCUUCCACUGGAUGACGACGGGUUAUCCGGCGGUCGACGCACGGUCAUGCACCCCC > GAUCCGUCGCCCCCACCACCCCGCGGAUUCUGGUCUCGACCGGAAGCCGUAUUGGGCGGGGACGGGCGGCGG > UCCGGUGCUGAAGCCGGCGACAGUUGCCCGAGUCAGCCACUUUCAAAAUUUGUUGGUUAAGUAACUUAGUAG > CUUAGCUUCGGAUUUUCGUAACAAAUUUGCUGUUCAGAACACUUCCAUGUACGCGGCAUUGCCGAGCAAUUU > GCCCAUUCUUUU > > > Publication: > The Drosophila 7SK snRNP and the essential role of dHEXIM in development. > Nguyen > D<http://www.ncbi.nlm.nih.gov/pubmed?term=%22Nguyen%20D%22%5BAuthor%5D>, > Krueger > BJ<http://www.ncbi.nlm.nih.gov/pubmed?term=%22Krueger%20BJ%22%5BAuthor%5D>, > Sedore > SC<http://www.ncbi.nlm.nih.gov/pubmed?term=%22Sedore%20SC%22%5BAuthor%5D>, > Brogie > JE<http://www.ncbi.nlm.nih.gov/pubmed?term=%22Brogie%20JE%22%5BAuthor%5D>, > Rogers > JT<http://www.ncbi.nlm.nih.gov/pubmed?term=%22Rogers%20JT%22%5BAuthor%5D>, > Rajendra > TK<http://www.ncbi.nlm.nih.gov/pubmed?term=%22Rajendra%20TK%22%5BAuthor%5D>, > Saunders > A<http://www.ncbi.nlm.nih.gov/pubmed?term=%22Saunders%20A%22%5BAuthor%5D>, > Matera > AG<http://www.ncbi.nlm.nih.gov/pubmed?term=%22Matera%20AG%22%5BAuthor%5D>, > Lis JT<http://www.ncbi.nlm.nih.gov/pubmed?term=%22Lis%20JT%22%5BAuthor%5D>, > Uguen P<http://www.ncbi.nlm.nih.gov/pubmed?term=%22Uguen%20P%22%5BAuthor%5D>, > Price > DH<http://www.ncbi.nlm.nih.gov/pubmed?term=%22Price%20DH%22%5BAuthor%5D>. > > PMID:22379134 > Regulation of the positive transcription elongation factor, P-TEFb, plays a > major role in controlling mammalian transcription and this is accomplished in > part by controlled release of P-TEFb from the 7SK snRNP that sequesters the > kinase in an inactive state. We demonstrate here that a similar P-TEFb > control system exists in Drosophila. We show that an RNA previously suggested > to be a 7SK homolog is, in fact, associated with P-TEFb, through the action > of a homolog of the human HEXIM1/2 proteins (dHEXIM). In addition, a > Drosophila La related protein (now called dLARP7) is shown to be the > functional homolog of human LARP7. The Drosophila 7SK snRNP (d7SK snRNP) > responded to treatment of cells with P-TEFb inhibitors and to nuclease > treatment of cell lysates by releasing P-TEFb. Supporting a critical role for > the d7SK snRNP in Drosophila development, dLARP7 and dHEXIM were found to be > ubiquitously expressed throughout embryos and tissues at all stages. > Importantly, knockdown of ! dH! > EXIM was embryonic lethal, and reduction of dHEXIM in specific tissues led > to serious developmental defects. Our results suggest that regulation of > P-TEFb by the d7SK snRNP is essential for the growth and differentiation of > tissues required during Drosophila development. > > > David H. Price > Professor of Biochemistry > University of Iowa > 375 Newton Rd. > Iowa City, IA 52242 > > (319) 335-7910 > http://www.uiowa.edu/~pricelab/ > > _______________________________________________ > Genome maillist - [email protected] > https://lists.soe.ucsc.edu/mailman/listinfo/genome _______________________________________________ Genome maillist - [email protected] https://lists.soe.ucsc.edu/mailman/listinfo/genome
