Thank you very much, Galt. I spent a long time searching for it and still managed to miss the -out=pslx option.
________________________________ From: Galt Barber [mailto:[email protected]] Sent: Friday, July 13, 2012 1:33 PM To: Majumdar, Abir Cc: [email protected] Subject: Re: [Genome] Standalone BLAT hg19: Print aligned section of sequence to psl Hi, Abir! You can either use the -out=pslx format or the program pslPretty. pslx output will add two more columns at the end of each psl row. These are the query and target sequences. Each contains a comma-separated list of sequence from the aligning blocks. You will be able to see mismatches, but the aligning blocks have no gaps or unaligned sequence. Of course pslx files will probably be bigger than psl. If you download or compile pslPretty, it can display the psl record in a human friendly format that will show sequence. Of course the original 2bit or fasta files used to generate the psl records must be available. -Galt On Fri, Jul 13, 2012 at 10:12 AM, Majumdar, Abir <[email protected]> wrote: Hello! I'm running a standalone version of BLAT. Is there an easy way to print to the output only the section of the sequence that was aligned? For example, if I align the sequence >786 AAATTTTAAACTAATACATCAGTTCTTCTAAATACCTTCTATAATACATCCAATAAAATAGAAACAGTTTTC AGTGAATGTCATAATCAAGGACGCTGTA According to the 'details' of web BLAT, The first 75 bases align with chr2 AAATTTTAAACTAATACATCAGTTCTTCTAAATACCTTCTATAATACATCCAATAAAATAGAAACAGTTTTC AGT While the rest align with chr12 (probably indicative of a translocation), along with some other irrelevant alignment results. So the question is: is there an easy way to print those first 75 bases that aligned with chr2 (along with the other respective aligned sections) directly onto the psl output? This will help me with processing the output and discarding extraneous results. Thank you, Abir Majumdar _______________________________________________ Genome maillist - [email protected] https://lists.soe.ucsc.edu/mailman/listinfo/genome _______________________________________________ Genome maillist - [email protected] https://lists.soe.ucsc.edu/mailman/listinfo/genome
