I don't get this. Look at this.
OK When I run wc -l on file it must have got cached and the machine has 256M of
RAM but still I would say that was fast enough by any standards.
11K line is no big deal. I have run grep queries on 85MB cobol source dump in
around 20sec when I was working on a performance tuning project. That was a
Pentium 200 with 32MB RAM.(OK I got the system administrator off GNOME first but
that' a different story...)
And please, set some wrapping in your mail client. Poor souls like us can not
read this.
Shridhar
-------------------------------------------------------------------------------
[shridhar@perth Cdna]$ ls -al
total 48115
drwxr-xr-x 3 mushtaq cvs 296 Sep 29 16:21 ./
drwxrwxr-x 9 shridhar cvs 1064 Sep 27 11:13 ../
-rw-r--r-- 1 mushtaq cvs 166 Sep 25 14:09 conformdb.log
-rw-r--r-- 1 mushtaq cvs 2665232 Sep 25 14:09 conformdb.nhr
-rw-r--r-- 1 mushtaq cvs 287212 Sep 25 14:09 conformdb.nin
-rw-r--r-- 1 mushtaq cvs 1126372 Sep 25 14:09 conformdb.nsd
-rw-r--r-- 1 mushtaq cvs 23637 Sep 25 14:09 conformdb.nsi
-rw-r--r-- 1 mushtaq cvs 8407606 Sep 25 14:09 conformdb.nsq
-r--r--r-- 1 mushtaq cvs 36744512 Sep 25 14:05 ensembl.cdna
drwxr-xr-x 2 mushtaq cvs 656 Sep 27 13:57 Genes/
[shridhar@perth Cdna]$ file ensembl.cdna
ensembl.cdna: ASCII text
[shridhar@perth Cdna]$ wc -l ensembl.cdna
594720 ensembl.cdna
[shridhar@perth Cdna]$ time head -300000 ensembl.cdna |tail -1
0.13user 0.20system 0:00.54elapsed 61%CPU (0avgtext+0avgdata 0maxresident)k
0inputs+0outputs (131major+23minor)pagefaults 0swaps
GGGGCTCCAGGCGCCCCTGTGATTACCTCCTACTGCCACCATGGCGCTCATTCAGATTCC
[shridhar@perth Cdna]$ free
total used free shared buffers cached
Mem: 255580 252048 3532 128 44768 173744
-/+ buffers/cache: 33536 222044
Swap: 401616 120 401496
[shridhar@perth Cdna]$
-------------------------------------------------------------------------------
Narayanamoorthy Srinivasan wrote:
>
> I wrote a shell script access a very big text file which happens to read the file
>line by line. When i use the command "head -$LINE_NO | tail -1" to retrieve a
>particular line, the process becomes very slow when accessing a big file that
>contains 11,000 lines.
> Is any other solution for it.
_______________________________________________
linux-india-help mailing list
[EMAIL PROTECTED]
https://lists.sourceforge.net/lists/listinfo/linux-india-help
