Thanks Wolfgang, this works perfectly. I will add this hint tomorrow to the Wiki.
> On 23 Apr 2020, at 23:50, Wolfgang Schuster > <wolfgang.schuster.li...@gmail.com> wrote: > > Benjamin Buchmuller schrieb am 23.04.2020 um 23:16: >> Hi Rik, >> Thanks for the fast reply! Your example works indeed nicely. However, within >> this solution my problem has shifted now (fully) towards breaking after the >> same number of characters, which seems to work for your sample string, but >> not for the sequences that I need to place. >> What I would like to achieve is something like: >> 5’-GATTGCTTACTCCTGGTTGG >> TGGGGCTTACATTCTGTCGCCTC >> AAAACTACTAGAGCCGGCATATT >> CTAGAAGGGCCGCCTTCATGTGG >> etc. >> (There might be hyphens or not, this is not so much important to me.) >> But what I get is currently: >> 5'-GATTGCTTACTCCTG- >> GTTGGTGGGGCTTACATTCT- >> GTCGCCTCAAAACTACTA- >> GAGCCGGCATATTCTA- >> GAAGGGCCGCCTTCATGTGGC- >> etc. >> Which looks ragged with \tt. Certainly, this is because ConTeXt applies the >> default hyphenation pattern. But I guess, there might be no “no language” >> pattern or is there? Also, I agree, it’s a bit odd that nright/nleft seem to >> make no difference towards the result. > > Hans posted a solution for a similar problem a few years ago [1] > which can be adapted to your problem. > > \startluacode > > local shared = { > start = 1, > length = 1, > before = nil, > after = nil, > left = false, > right = false, > } > > local all = table.setmetatableindex({ }, function(t,k) > return shared > end) > > languages.hyphenators.traditional.installmethod("dna", > function(dictionary,word,n) > return all > end > ) > \stopluacode > > \definehyphenationfeatures > [dna] > [characters=all, > alternative=dna] > > \starttext > > \startframedtext[width=6cm,style=mono] > \sethyphenationfeatures[dna] > \setuphyphenation[method=traditional] > GATTGCTTACTCCTGGTTGG% > TGGGGCTTACATTCTGTCGCCTC% > AAAACTACTAGAGCCGGCATATT% > CTAGAAGGGCCGCCTTCATGTGG% > \stopframedtext > > \stoptext > > [1] https://mailman.ntg.nl/pipermail/ntg-context/2017/089106.html > > Wolfgang ___________________________________________________________________________________ If your question is of interest to others as well, please add an entry to the Wiki! maillist : ntg-context@ntg.nl / http://www.ntg.nl/mailman/listinfo/ntg-context webpage : http://www.pragma-ade.nl / http://context.aanhet.net archive : https://bitbucket.org/phg/context-mirror/commits/ wiki : http://contextgarden.net ___________________________________________________________________________________