Hi Rik,

thank you as well, this works also nicely. I’ve created a wiki page meanwhile 
for wrapping text containing both solutions and the post on SHA keys.

https://www.contextgarden.net/Wrapping

Cheers


Benjamin

> On 24 Apr 2020, at 00:45, Rik Kabel <cont...@rik.users.panix.com> wrote:
> 
> 
> 
> On 4/23/2020 17:50, Wolfgang Schuster wrote:
>> Benjamin Buchmuller schrieb am 23.04.2020 um 23:16: 
>>> Hi Rik, 
>>> 
>>> Thanks for the fast reply! Your example works indeed nicely. However, 
>>> within this solution my problem has shifted now (fully) towards breaking 
>>> after the same number of characters, which seems to work for your sample 
>>> string, but not for the sequences that I need to place. 
>>> 
>>> What I would like to achieve is something like: 
>>> 
>>> 5’-GATTGCTTACTCCTGGTTGG 
>>> TGGGGCTTACATTCTGTCGCCTC 
>>> AAAACTACTAGAGCCGGCATATT 
>>> CTAGAAGGGCCGCCTTCATGTGG 
>>> etc. 
>>> 
>>> (There might be hyphens or not, this is not so much important to me.) 
>>> 
>>> But what I get is currently: 
>>> 
>>> 5'-GATTGCTTACTCCTG- 
>>> GTTGGTGGGGCTTACATTCT- 
>>> GTCGCCTCAAAACTACTA- 
>>> GAGCCGGCATATTCTA- 
>>> GAAGGGCCGCCTTCATGTGGC- 
>>> etc. 
>>> 
>>> Which looks ragged with \tt. Certainly, this is because ConTeXt applies the 
>>> default hyphenation pattern. But I guess, there might be no “no language” 
>>> pattern or is there? Also, I agree, it’s a bit odd that nright/nleft seem 
>>> to make no difference towards the result. 
>> 
>> Hans posted a solution for a similar problem a few years ago [1] 
>> which can be adapted to your problem. 
>> 
>> \startluacode 
>> 
>>      local shared = { 
>>          start  = 1, 
>>          length = 1, 
>>          before = nil, 
>>          after  = nil, 
>>          left   = false, 
>>          right  = false, 
>>      } 
>> 
>>      local all = table.setmetatableindex({ }, function(t,k) 
>>          return shared 
>>      end) 
>> 
>>      languages.hyphenators.traditional.installmethod("dna", 
>>          function(dictionary,word,n) 
>>              return all 
>>          end 
>>      ) 
>> \stopluacode 
>> 
>> \definehyphenationfeatures 
>>   [dna] 
>>   [characters=all, 
>>    alternative=dna] 
>> 
>> \starttext 
>> 
>> \startframedtext[width=6cm,style=mono] 
>>   \sethyphenationfeatures[dna] 
>>   \setuphyphenation[method=traditional] 
>>   GATTGCTTACTCCTGGTTGG% 
>>   TGGGGCTTACATTCTGTCGCCTC% 
>>   AAAACTACTAGAGCCGGCATATT% 
>>   CTAGAAGGGCCGCCTTCATGTGG% 
>> \stopframedtext 
>> 
>> \stoptext 
>> 
>> [1] https://mailman.ntg.nl/pipermail/ntg-context/2017/089106.html 
>> 
>> Wolfgang 
>> 
> And without lua, just two lines of ConTeXt with a bit of TeX:
> 
> \define[1]\DNA{\handletokens #1\with\DNAspacer}
> \define[1]\DNAspacer{#1\hskip 2.3pt plus .1pt}
> \define[2]\mycommandc{
>     \startxrow
>     \startxcell o#1 \stopxcell
>     \startxcell {\tt\WORD{\DNA{5'-#2}}}\stopxcell
>     \stopxrow
>     }
> \starttext
> \setupxtable[width=5cm]
> \startxtable
> \mycommandc{C}{gattgcttactcctggttggtggggcttacattctgtcgcctcaaaactactagagccggcatattctagaagggccgccttcatgtggcctagggcaccatcgcgtacgagggcaaaaaatgagtttaccgctgcgaagtctctacgtcacggccaaccacagtcctgctcccaacgaaatttagacgctgtcgtgaaacctgaattcgaggataagccgcgtcatgaagagtctactg}
> \stopxtable
> \stoptext
> 
> Modify the skip as you see fit.
> 
> -- 
> Rik
> 

___________________________________________________________________________________
If your question is of interest to others as well, please add an entry to the 
Wiki!

maillist : ntg-context@ntg.nl / http://www.ntg.nl/mailman/listinfo/ntg-context
webpage  : http://www.pragma-ade.nl / http://context.aanhet.net
archive  : https://bitbucket.org/phg/context-mirror/commits/
wiki     : http://contextgarden.net
___________________________________________________________________________________

Reply via email to