Hi Rik, thank you as well, this works also nicely. I’ve created a wiki page meanwhile for wrapping text containing both solutions and the post on SHA keys.
https://www.contextgarden.net/Wrapping Cheers Benjamin > On 24 Apr 2020, at 00:45, Rik Kabel <cont...@rik.users.panix.com> wrote: > > > > On 4/23/2020 17:50, Wolfgang Schuster wrote: >> Benjamin Buchmuller schrieb am 23.04.2020 um 23:16: >>> Hi Rik, >>> >>> Thanks for the fast reply! Your example works indeed nicely. However, >>> within this solution my problem has shifted now (fully) towards breaking >>> after the same number of characters, which seems to work for your sample >>> string, but not for the sequences that I need to place. >>> >>> What I would like to achieve is something like: >>> >>> 5’-GATTGCTTACTCCTGGTTGG >>> TGGGGCTTACATTCTGTCGCCTC >>> AAAACTACTAGAGCCGGCATATT >>> CTAGAAGGGCCGCCTTCATGTGG >>> etc. >>> >>> (There might be hyphens or not, this is not so much important to me.) >>> >>> But what I get is currently: >>> >>> 5'-GATTGCTTACTCCTG- >>> GTTGGTGGGGCTTACATTCT- >>> GTCGCCTCAAAACTACTA- >>> GAGCCGGCATATTCTA- >>> GAAGGGCCGCCTTCATGTGGC- >>> etc. >>> >>> Which looks ragged with \tt. Certainly, this is because ConTeXt applies the >>> default hyphenation pattern. But I guess, there might be no “no language” >>> pattern or is there? Also, I agree, it’s a bit odd that nright/nleft seem >>> to make no difference towards the result. >> >> Hans posted a solution for a similar problem a few years ago [1] >> which can be adapted to your problem. >> >> \startluacode >> >> local shared = { >> start = 1, >> length = 1, >> before = nil, >> after = nil, >> left = false, >> right = false, >> } >> >> local all = table.setmetatableindex({ }, function(t,k) >> return shared >> end) >> >> languages.hyphenators.traditional.installmethod("dna", >> function(dictionary,word,n) >> return all >> end >> ) >> \stopluacode >> >> \definehyphenationfeatures >> [dna] >> [characters=all, >> alternative=dna] >> >> \starttext >> >> \startframedtext[width=6cm,style=mono] >> \sethyphenationfeatures[dna] >> \setuphyphenation[method=traditional] >> GATTGCTTACTCCTGGTTGG% >> TGGGGCTTACATTCTGTCGCCTC% >> AAAACTACTAGAGCCGGCATATT% >> CTAGAAGGGCCGCCTTCATGTGG% >> \stopframedtext >> >> \stoptext >> >> [1] https://mailman.ntg.nl/pipermail/ntg-context/2017/089106.html >> >> Wolfgang >> > And without lua, just two lines of ConTeXt with a bit of TeX: > > \define[1]\DNA{\handletokens #1\with\DNAspacer} > \define[1]\DNAspacer{#1\hskip 2.3pt plus .1pt} > \define[2]\mycommandc{ > \startxrow > \startxcell o#1 \stopxcell > \startxcell {\tt\WORD{\DNA{5'-#2}}}\stopxcell > \stopxrow > } > \starttext > \setupxtable[width=5cm] > \startxtable > \mycommandc{C}{gattgcttactcctggttggtggggcttacattctgtcgcctcaaaactactagagccggcatattctagaagggccgccttcatgtggcctagggcaccatcgcgtacgagggcaaaaaatgagtttaccgctgcgaagtctctacgtcacggccaaccacagtcctgctcccaacgaaatttagacgctgtcgtgaaacctgaattcgaggataagccgcgtcatgaagagtctactg} > \stopxtable > \stoptext > > Modify the skip as you see fit. > > -- > Rik > ___________________________________________________________________________________ If your question is of interest to others as well, please add an entry to the Wiki! maillist : ntg-context@ntg.nl / http://www.ntg.nl/mailman/listinfo/ntg-context webpage : http://www.pragma-ade.nl / http://context.aanhet.net archive : https://bitbucket.org/phg/context-mirror/commits/ wiki : http://contextgarden.net ___________________________________________________________________________________
