Marc (>):
> hello perl6 people,
>
> On
>
> This is perl6 version 2012.09.1
> built on parrot 4.6.0 revision 0
>
> When i try to run
>
> use v6;
> use Test;
> for 'GATGGAACTTGACTACGTAAATT' {
> s:g/T/U/;
> is $_
> , 'GAUGGAACUUGACUACGUAAAUU'
> , 'RNA';
> }
>
> I get
>
> Cannot assign to a non-container
> in sub infix:<=> at src/gen/CORE.setting:11692
> in block at /tmp/ZZZ:4
>
> As far as i understand from the doc, s:g/T/U/ is a valid syntax. any idea?
It's valid syntax. The error you're getting is not a syntax error;
it's a run-time error complaining about assigning to something that
isn't a container.
What you're assigning to is 'GATGGAACTTGACTACGTAAATT', a Str object.
That's a bit like trying to assign to the number 5. It should produce
an error, and it does. You need to put it into a variable, or an array
element, or a hash value -- in short, a "container" -- for it to work.
I think part of what felt confusing about this is that you did things
in a 'for' loop, so the assignment directly to a Str isn't that
obvious.
By the way, that 'for' loop over a single element is usually spelled
'given' in Perl 6.
I would write your code like this:
use v6;
use Test;
{
$_ = 'GATGGAACTTGACTACGTAAATT';
s:g/T/U/;
is $_,
'GAUGGAACUUGACUACGUAAAUU',
'RNA';
}
// Carl
