I imagine it's the same problem as this Perl 5 code:
use Test::More;
for ('GATGGAACTTGACTACGTAAATT') {
s/T/U/g;
is $_, 'GAUGGAACUUGACUACGUAAAUU', 'RNA';
}
Since $_ is an alias for each element of the list and the only element in
the list is a constant string and you can't modify constants, you get the
error. Changing your code to:
use v6;
use Test;
my $x = 'GATGGAACTTGACTACGTAAATT';
for $x {
s:g/T/U/;
is $_ , 'GAUGGAACUUGACUACGUAAAUU' , 'RNA';
}
Does indeed work.
Though, if what I said is true, the error message is Less Than Awesome. I
wonder could it be made more helpful?
Hope this helps,
-Scott
On Wed, Oct 24, 2012 at 7:35 AM, Marc Chantreux <kha...@phear.org> wrote:
> hello perl6 people,
>
> On
>
> This is perl6 version 2012.09.1
> built on parrot 4.6.0 revision 0
>
> When i try to run
>
> use v6;
> use Test;
> for 'GATGGAACTTGACTACGTAAATT' {
> s:g/T/U/;
> is $_
> , 'GAUGGAACUUGACUACGUAAAUU'
> , 'RNA';
> }
>
> I get
>
> Cannot assign to a non-container
> in sub infix:<=> at src/gen/CORE.setting:11692
> in block at /tmp/ZZZ:4
>
> As far as i understand from the doc, s:g/T/U/ is a valid syntax. any idea?
>
> regards
> marc
>
