I've had a look at the Leetcode site. It turns out that it doesn't
admit J/APL/K etc solutions. I found myself "submitting" an
empty Ruby shell! (I'd thought the submit button would open
a new page...)
Their latest problem is very easy to solve in J, namely to list the
running minimum-over-3-item-windows in a numeric vector,
but they're looking for linear-time solutions using fancy
techniques which hardly matter to J-ers, but might impress in a
C++/C/C#/Ruby/... job interview.
Sorry - getting away from Jprogramming as such,
M
On 21/07/2015 08:29, Mike Day wrote:
I came up with the same as Vijay - this variant allows
you to vary the required length of the sub-string:
s =: 'AAAAACCCCCAAAAACCCCCCAAAAAGGGTTT'
v =: ((~.#~1<#/.~)@(<\))
4{. 5 v s
+-----+-----+-----+-----+
|AAAAA|AAAAC|AAACC|AACCC|
+-----+-----+-----+-----+
What's your Project Euler Moniker, Jon? I'm "Mike", as
here. It's a long time since I had solved 100% of the
problems.
Cheers,
Mike
On 21/07/2015 05:49, Vijay Lulla wrote:
Using slightly less space
(~. #~ 1 < #/.~)@(10 ]\ ]) s
On Mon, Jul 20, 2015 at 11:59 PM, Tikkanz <[email protected]> wrote:
(i.~ ~: i:~) will find duplicates so how about:
~.@(#~ i.~ ~: i:~)@(10 ]\ ]) s
AAAAACCCCC
CCCCCAAAAA
On Tue, Jul 21, 2015 at 3:51 PM, Jon Hough <[email protected]> wrote:
This is a problem from leetcode.com (similar to Project Euler)
https://leetcode.com/problems/repeated-dna-sequences/
The problem is to find all 10 letter repeated subsequences from a DNA
string (made of C,G,A,T characters).
My solution:
func =: (I.@:(1&<)@:>@:(1&{)@:(~. ,: <"0@:(#/.~)) {
])@:(<"1@:(10&(]\)))
e.g. s =: 'AAAAACCCCCAAAAACCCCCCAAAAAGGGTTT' NB. see the link for this
definition
func s
┌──────────┬──────────┐
│AAAAACCCCC│CCCCCAAAAA│
└──────────┴──────────┘
---
This email has been checked for viruses by Avast antivirus software.
https://www.avast.com/antivirus
----------------------------------------------------------------------
For information about J forums see http://www.jsoftware.com/forums.htm
---
This email has been checked for viruses by Avast antivirus software.
https://www.avast.com/antivirus
----------------------------------------------------------------------
For information about J forums see http://www.jsoftware.com/forums.htm
