Thanks for the explanation!

On Tue, Jul 21, 2015 at 4:13 PM, Henry Rich <[email protected]> wrote:
>    <._2855392203 + 2^32
> 1439575093
>
> The upper bits of the CRC-32 should be discarded:
>
> 4bminus1 =. (26 b.) 32 (33 b.) _32 (33 b.) _1
>    fourbminus1 (17 b.) f 'assiduously avoid any and all asinine
> alliterations'
> 1439575093
>
> Henry Rich
>
> On 7/21/2015 3:06 PM, Vijay Lulla wrote:
>>
>> Out of curiosity, I'm getting different value for the example listed
>> under 128!:3.  Shouldn't it be the same as listed on the page?
>>
>> Below is from my J session
>>
>>     f '123456789'
>> _873187034
>>     f 'assiduously avoid any and all asinine alliterations'  NB.
>> Different from the listed example
>> _2855392203
>>     JVERSION
>> Engine: j803/2014-10-19-11:11:11
>> Library: 8.04.06
>> Qt IDE: 1.4.3/5.4.2
>> Platform: Win 64
>> Installer: J804 install
>> InstallPath: h:/utilities/j64-804
>>
>>
>> On Tue, Jul 21, 2015 at 11:48 AM, Raul Miller <[email protected]>
>> wrote:
>>>
>>> You can't have an inverse crc, because crc is a lossy transformation.
>>> You are basically relying on statistics to avoid collisions (different
>>> strings with the same crc).
>>>
>>> So actual use would look something like:
>>>
>>> step one: get the distinct crcs which are in use.
>>>
>>> step two: go over the data again and for each string find its crc, and
>>> check that some other relevant string isn't producing the same crc.
>>> (If there are, you'll need further work to untangle them.)
>>>
>>> --
>>> Raul
>>>
>>> On Tue, Jul 21, 2015 at 10:34 AM, Mike Day <[email protected]>
>>> wrote:
>>>>
>>>> That's neat,  but it's a bit messy retrieving the actual
>>>> substrings rather than their encoded forms.
>>>>
>>>> This does it,
>>>>     10(]{~i.@[+/~((I.@:(1<#/.~))@:( (128!:3)\ ]))) s
>>>>
>>>> AAAAACCCCC
>>>>
>>>> CCCCCAAAAA
>>>>
>>>>
>>>> but it would be much better with an inverse CRC;
>>>> however that doesn't seem to be supported in J.
>>>>
>>>>
>>>> Is there a maximum window size for this approach?
>>>>
>>>> Thanks,
>>>>
>>>> Mike
>>>>
>>>>
>>>> On 21/07/2015 14:37, Henry Rich wrote:
>>>>>
>>>>>
>>>>> For longer subsequences consider using
>>>>>
>>>>> (10 (128!:3)\ ])
>>>>>
>>>>> to reduce the size of the intermediate array.
>>>>>
>>>>> Henry Rich
>>>>>
>>>>> On 7/21/2015 12:49 AM, Vijay Lulla wrote:
>>>>>>
>>>>>>
>>>>>> Using slightly less space
>>>>>>
>>>>>> (~. #~ 1 < #/.~)@(10 ]\ ]) s
>>>>>>
>>>>>> On Mon, Jul 20, 2015 at 11:59 PM, Tikkanz <[email protected]> wrote:
>>>>>>>
>>>>>>>
>>>>>>> (i.~ ~: i:~) will find duplicates so how about:
>>>>>>>
>>>>>>>       ~.@(#~ i.~ ~: i:~)@(10 ]\ ]) s
>>>>>>>
>>>>>>> AAAAACCCCC
>>>>>>>
>>>>>>> CCCCCAAAAA
>>>>>>>
>>>>>>>
>>>>>>>
>>>>>>> On Tue, Jul 21, 2015 at 3:51 PM, Jon Hough <[email protected]>
>>>>>>> wrote:
>>>>>>>
>>>>>>>> This is a problem from leetcode.com (similar to Project Euler)
>>>>>>>> https://leetcode.com/problems/repeated-dna-sequences/
>>>>>>>> The problem is to find all 10 letter repeated subsequences from a
>>>>>>>> DNA
>>>>>>>> string (made of C,G,A,T characters).
>>>>>>>> My solution:
>>>>>>>> func =: (I.@:(1&<)@:>@:(1&{)@:(~. ,: <"0@:(#/.~)) {
>>>>>>>> ])@:(<"1@:(10&(]\)))
>>>>>>>> e.g. s =: 'AAAAACCCCCAAAAACCCCCCAAAAAGGGTTT' NB. see the link for
>>>>>>>> this
>>>>>>>> definition
>>>>>>>> func s
>>>>>>>> ┌──────────┬──────────┐
>>>>>>>>
>>>>>>>> │AAAAACCCCC│CCCCCAAAAA│
>>>>>>>>
>>>>>>>> └──────────┴──────────┘
>>>>>>>>
>>>>>>>>
>>>>>>>>
>>>>>>>> It is not very pretty. Can anyone improve on it?
>>>>
>>>>
>>>>
>>>>
>>>> ---
>>>> This email has been checked for viruses by Avast antivirus software.
>>>> https://www.avast.com/antivirus
>>>>
>>>>
>>>> ----------------------------------------------------------------------
>>>> For information about J forums see http://www.jsoftware.com/forums.htm
>>>
>>> ----------------------------------------------------------------------
>>> For information about J forums see http://www.jsoftware.com/forums.htm
>>
>> ----------------------------------------------------------------------
>> For information about J forums see http://www.jsoftware.com/forums.htm
>>
> ----------------------------------------------------------------------
> For information about J forums see http://www.jsoftware.com/forums.htm
----------------------------------------------------------------------
For information about J forums see http://www.jsoftware.com/forums.htm

Reply via email to