* evilweasel:
Hi folks,I am a newbie to python, and I would be grateful if someone could point out the mistake in my program. Basically, I have a huge text file similar to the format below: AAAAAGACTCGAGTGCGCGGA 0 AAAAAGATAAGCTAATTAAGCTACTGG 0 AAAAAGATAAGCTAATTAAGCTACTGGGTT 1 AAAAAGGGGGCTCACAGGGGAGGGGTAT 1 AAAAAGGTCGCCTGACGGCTGC 0 The text is nothing but DNA sequences, and there is a number next to it. What I will have to do is, ignore those lines that have 0 in it, and print all other lines (excluding the number) in a new text file (in a particular format called as FASTA format). This is the program I wrote for that: seq1 = [] list1 = [] lister = [] listers = [] listers1 = [] a = [] d = [] i = 0 j = 0 num = 0 file1 = open(sys.argv[1], 'r') for line in file1: if not line.startswith('\n'): seq1 = line.split() if len(seq1) == 0: continue a = seq1[0] list1.append(a) d = seq1[1] lister.append(d) b = len(lister) for j in range(0, b): if lister[j] == 0: listers.append(j) else: listers1.append(j) print listers1 resultsfile = open("sequences1.txt", 'w') for i in listers1: resultsfile.write('\n>seq' + str(i) + '\n' + list1[i] + '\n') But this isn't working.
What do you mean by "isn't working"?
I am not able to find the bug in this. I would be thankful if someone could point it out. Thanks in advance!
What do you expect as output, and what do you actually get as output? Cheers, - Alf -- http://mail.python.org/mailman/listinfo/python-list
