On Thu, Jan 28, 2010 at 4:28 PM, Krister Svanlund <[email protected]> wrote: > On Thu, Jan 28, 2010 at 4:07 PM, evilweasel > <[email protected]> wrote: >> Hi folks, >> >> I am a newbie to python, and I would be grateful if someone could >> point out the mistake in my program. Basically, I have a huge text >> file similar to the format below: >> >> AAAAAGACTCGAGTGCGCGGA 0 >> AAAAAGATAAGCTAATTAAGCTACTGG 0 >> AAAAAGATAAGCTAATTAAGCTACTGGGTT 1 >> AAAAAGGGGGCTCACAGGGGAGGGGTAT 1 >> AAAAAGGTCGCCTGACGGCTGC 0 >> >> The text is nothing but DNA sequences, and there is a number next to >> it. What I will have to do is, ignore those lines that have 0 in it, >> and print all other lines (excluding the number) in a new text file >> (in a particular format called as FASTA format). This is the program I >> wrote for that: >> >> seq1 = [] >> list1 = [] >> lister = [] >> listers = [] >> listers1 = [] >> a = [] >> d = [] >> i = 0 >> j = 0 >> num = 0 >> >> file1 = open(sys.argv[1], 'r') >> for line in file1: >> if not line.startswith('\n'): >> seq1 = line.split() >> if len(seq1) == 0: >> continue >> >> a = seq1[0] >> list1.append(a) >> >> d = seq1[1] >> lister.append(d) >> >> >> b = len(lister) >> for j in range(0, b): >> if lister[j] == 0: >> listers.append(j) >> else: >> listers1.append(j) >> >> >> print listers1 >> resultsfile = open("sequences1.txt", 'w') >> for i in listers1: >> resultsfile.write('\n>seq' + str(i) + '\n' + list1[i] + '\n') >> >> But this isn't working. I am not able to find the bug in this. I would >> be thankful if someone could point it out. Thanks in advance! >> >> Cheers! > > I'm not totaly sure what you want to do but try this (python2.6+): > > newlines = [] > > with open(sys.argv[1], 'r') as f: > text = f.read(); > for line in text.splitlines(): > if not line.strip() and line.strip().endswith('1'): newlines.append('seq'+line.strip()[:-1].strip()) > > with open(sys.argv[2], 'w') as f: > f.write('\n'.join(newlines)) >
Gah, made some errors -- http://mail.python.org/mailman/listinfo/python-list
