Re: [ccp4bb] Help! weird thing
Dear all, Thank you very much for all the great suggestions on my case. Yes, I run the latest version of Phaser in Phenix. The analysis showed that there is one non-origin distinct peak more than 15 angstroms from the origin. 44.1% origin:FRAC 0.000 0.042 0.500 (ORTH -15.72.8 103.5) I managed to find four copies with the latest Phaser. After 50 cycles of rigid body refinement and 50 cycles of jelly body refinement, Rfree/R goes around 55/52. It is really hard for me to do model building at this point, because there is pretty much no new density. Compare to model building and refinement with normal dataset (no pseudo translation NCS), are there any special tricks or tips for structure determination from dataset with pseudo translation? Thanks again! Have a nice evening or morning or afternoon! Zhihong On Mar 12, 2012, at 10:16 AM, Randy Read wrote: > Airlie points out that what I said about the ccp4i interface wasn't correct! > In order to keep the ccp4i interface in synch with the version of Phaser, > we've started distributing the ccp4i files with the source code. The ones on > our website are for an older version of Phaser, but the latest ones will come > with the Phenix download that gives you the latest executable. > > Apologies to anyone who was quick enough to download and install the wrong > ccp4i files already! > > Best wishes, > > Randy Read > > On 12 Mar 2012, at 16:47, Randy Read wrote: > >> Yes, the current version of Phaser will do the same test that xtriage >> carries out, and if it finds a sufficiently high non-origin Patterson peak, >> it will automatically characterise the translational NCS and use this for >> molecular replacement. This is working pretty well in our tests. >> >> In the near future you will be able to get the current version of Phaser as >> part of the upcoming CCP4 release, but at the moment the easiest way to get >> it is to download a recent version of Phenix. You should be able to run >> that through ccp4i by downloading and installing the updated GUI files from >> our website (and getting ccp4i to interpret the command "phaser" as >> "phenix.phaser"). >> >> Best wishes, >> >> Randy Read >> >> On 12 Mar 2012, at 16:06, Anastassis Perrakis wrote: >> >>> Hi - >>> >>> I agree with Garib that its likely a pseudo-translation issue. >>> I also agree with that the advice he gives is correct, but ... >>> ... since I am evidently less smart to follow all these steps, >>> I like to use phenix.xtriage that will tell me if there is >>> pseudo-translation or not, >>> and will give a p-value for that being significant. Its at the end of the >>> text output. >>> >>> I am not sure if Phaser deals these days with pseudo-translation - I guess >>> Randy can tell us. >>> If not, there is a very simple trick to make Phaser work with >>> pseudo-translation, >>> but since I threw the ball to Randy's court and he told me the trick a few >>> years ago, >>> I will let him explain only if needed ;-) >>> >>> Best, >>> >>> Tassos >>> >>> On Mar 11, 2012, at 12:55, Garib N Murshudov wrote: >>> Hi Could you please check: 1) If there is psedotranslation. It could be done by using sfcheck, molrep, ctruncate or calculating patterson map and displaying using coot at 8-10 sigma level (it is my favourite method for analysis of pseudo translations), whole unit cell ( a bit bigger than whole unit cell). Then if you see large no origin peak (very likely along one of the axis, could be a). If yes then you have several options: using phaser - 1) reduce cell, find solution in smaller cell and then expand; 2) use molrep to solve. When there are two copies related with pseudo translation molrep can give you solution; 3) as far as I am aware latest version of phaser works with pseudo translation. If you have pseudtranslation you should be aware that even if you solve the structure starting R factors could be 70-80%. Then you may want to do 40 cycles of rigid body and 40-100 cycles of ljelly body 2) Check your space group in pdb and mtz file. They may not be consistent. I hope it helps. Garib On 11 Mar 2012, at 07:33, xiaoyazi2008 wrote: > Hi All, > > I have an interesting thing to share. > 2.3A dataset with good quality, P21 > Partial model is available (~60% of the target protein). > It seems that there are 4 copies in the ASU (Matthews_coef 2.6, > 53%solvent) > Molecular replacement gave two copies of the model (Z scores are R6.2, > T6.2, R6.8, T13.4). The solution is very clear. It could not locate the > rest two copies. > > However, a quick refmac5 refinement gave a very high R factor. > The funny part is the symmetry operation in Coot. > As shown in the JPEG figure, it looks like there should be another two > copies (based on strong fo-fc g
[ccp4bb] Postdoctoral research associate in fragment-based inhibitor design
We are seeking to appoint a Research Associate in the group of Dr Marko Hyvonen to develop chemical tools against signalling proteins using fragment-based drug discovery methods. The post is part of a Wellcome Trust funded, multi-disciplinary programme between Departments of Biochemistry (Prof Tom Blundell and Dr Marko Hyvonen), Chemistry (Prof Chris Abell and Dr David Spring) and the Hutchison/MRC Research Centre (Prof Ashok Venkitaraman and Dr Grahame McKenzie). Experience in all aspects of protein crystallography from construct design to structure refinement is essential. Experience with high-throughput crystallography, scripting and automation of crystallographic work-flow is highly desirable, experience with biophysical techniques such as ITC and Biacore an additional advantage. Informal enquiries about the post can be sent to Dr Marko Hyvonen at ma...@cryst.bioc.cam.ac.uk. Closing Date: 11 April 2012 Information on how to apply: http://www.jobs.cam.ac.uk/job/-14591/ best, Marko _ Marko Hyvonen Department of Biochemistry, University of Cambridge ma...@cryst.bioc.cam.ac.uk http://www-cryst.bioc.cam.ac.uk/groups/hyvonen tel:+44-(0)1223-766 044 mobile: +44-(0)7796-174 877 fax:+44-(0)1223-766 002 --
[ccp4bb] March 15, 2012 deadline- User proposal submission for Collaborative Crystallography at BCSB
Dear Users, The deadline for May/June 2012 Collaborative Crystallography proposals will be *Mar 15, 2012. * Through the Collaborative Crystallography Program (CC) at the Advanced Light Source (ALS), scientists can send protein crystals to Berkeley Center for Structural Biology (BCSB) staff researchers for data collection and analysis. The CC Program can provide a number of benefits to researchers: * Obtain high quality data and analysis through collaborating with expert beamline researchers; * Rapid turn around on projects; and * Reduced travel costs. To apply, please submit a proposal through the ALS General User proposal review process for beamtime allocation. Proposals are reviewed and ranked by the Proposal Study Panel, and beamtime is allocated accordingly. BCSB staff schedule the CC projects on Beamlines 5.0.1 and 5.0.2 to fit into the available resources. Only non-proprietary projects will be accepted. As a condition of participation, BCSB staff researchers who participate in data collection and/or analysis must be appropriately acknowledged - typically being included as authors on publications and in PDB depositions. Please consult the website for additional information at: http://bcsb.als.lbl.gov/wiki/index.php/Collaborative_Crystallography - How To Apply: To learn more, go to: http://www.als.lbl.gov/als/quickguide/becomealsuser.html To submit a proposal, go to: http://alsusweb.lbl.gov/. Scroll down to "*Structural Biology beamlines (includes protein SAXS)*" and click on "New Proposal." Enter your proposal information, with attention to the following details: * For question 3/First choice, select "5.0.1 (Monochromatic);" for question 3/Second choice, select "5.0.2 (MAD)." * Check box (yes) in response to question (7) "Do you want collaborative crystallography (beamline 5.0.1 or 5.0.2 only) * In question 4, please describe a specific research project with a clear end point. In order to request CC time for May/June 2012 allocation period, proposals must be submitted by *March 15, 2012.* The deadline for CC proposals for the time period July/August 2012 will be May 15, 2012. Regards, Banumathi Sankaran
[ccp4bb] CrystFEL: Software for FEL crystallography
Hi all,
This is just to draw the attention, of anyone who might find it
interesting, to the availability of the first public version of
CrystFEL: a new software suite for analysis of "serial femtosecond
crystallography" data acquired using free-electron laser sources such
as the Linac Coherent Light Source (LCLS). Early versions of CrystFEL
powered much of the analysis for the first demonstration of this
technique on small crystals of photosystem I which was published (and
discussed here) back in February last year. I described some aspects
of CrystFEL and its algorithms in my talk at the CCP4 study weekend a
couple of months ago.
CrystFEL comprises programs for indexing and integrating diffraction
patterns, scaling and merging intensities, simulating patterns,
calculating figures of merit for the data and visualising the results.
Supporting scripts are provided to help at all stages, including
importing data into CCP4 for further processing. The underlying shared
library ('libcrystfel') means that you can use CrystFEL's features in
your own programs or even incorporate them into other frameworks.
If you're interested, you can read more on the CrystFEL website (link
below) and in an article in Journal of Applied Crystallography which
will be published very soon (hopefully tomorrow).
http://www.desy.de/~twhite/crystfel/index.html
Questions, comments and bug reports/fixes to this address.
Thanks for reading!
Tom
Re: [ccp4bb] How to reduce R factor
Dipankar, An MR R-factor of 53% is close to what you get with a random, incorrect solution. Even for challenging MR cases, your MR R-factor should normally be under 50% before rigid-body refinement of the MR solution. As others have mentioned, you should not proceed directly to refinement unless you know your MR solution is sensible and you have fixed the obvious problems otherwise you may lock in some model bias. There are a few sanity checks you should perform before proceeding: 1. Inspect the model in Coot or Pymol (or whatever), turn on symmetry molecules, and inspect molecule packing in the lattice. If you don't get nicely packed molecules with reasonable intermolecular contacts (no major clashes or interpenetrating molecules, no "lonely" molecules) and obvious solvent channels, the space group is likely wrong. Run Phaser with the option to look at all alternative space groups. 2. Run a cell content analysis in Phaser. (You should do this first.) This feature uses the Matthews probability calculator to estimate the number of search models in the asymmetric unit. If you have too many/too few models in the ASU, you won't get a good solution. Inspecting packing of the lattice may alert you to having too many/too few protein chains in the ASU. 3. Inspect your electron density maps. If it is difficult to trace the main chain or see clear side chain density, it is not likely you have a solution. However, some incorrect solutions can sometimes give quasi-sensible-looking density. If your solution is decent, you should be able to see non-protein features in the difference maps, e.g. metal ions should stand out in metalloenzyme structures. It is possible that your search model contains features (N- and C-terminal secondary structures or loops) that are disordered in the crystal. Including these in the search model can cause problems with clashes and poor phasing. Again, inspecting the electron density and/or clashes in the MR solution may alert you to this issue. Modifying your search model appropriately may help. Or not. If you have reason to believe your search model is a good one, Phaser or Open-EPMR has never failed me, even with search models with just under 30% identity or high copy numbers per ASU. Cheers, ___ Roger S. Rowlett Gordon & Dorothy Kline Professor Department of Chemistry Colgate University 13 Oak Drive Hamilton, NY 13346 tel: (315)-228-7245 ofc: (315)-228-7395 fax: (315)-228-7935 email: rrowl...@colgate.edu On 3/14/2012 5:26 AM, Dipankar Manna wrote: Dear Crystallographers, Can anybody guide me how to reduce R-factor, means which are the basic parameters I have to look for to reduce the R-factor during refinement. I am newly learning the refinement. After running molrep R-factor is around 53% (100% identity), after rigid body refinement its showing around 49% and after restrained refinement its showing around 47%. Highest resolution is 2.5A. Regards Dipankar This e-mail and any files transmitted with it are for the sole use of the intended recipient(s) and may contain confidential and privileged information.If you are not the intended recipient, please contact the sender by reply e-mail and destroy all copies of the original message.Any unauthorized review, use, disclosure, dissemination, forwarding,printing or copying of this email or any action taken in reliance on this e-mail is strictly prohibited and may be unlawful. Visit us at http://www.aurigene.com
Re: [ccp4bb] How to reduce R factor
On Wed, 2012-03-14 at 09:26 +, Dipankar Manna wrote: > After running molrep R-factor is around 53% (100% identity), after > rigid body refinement its showing around 49% and after restrained > refinement its showing around 47%. Sounds like you didn't get a solution. With 100% identity MR in most cases works like a charm, so there must be something wrong with 1) Data processing - wrong spacegroup? Try processing your data in P1. If MR works after that, start working up to the higher symmetry. If you need specific advice from the bb, provide details on unit cell parameters, space group, R-merge, chi-square etc. Best of all, post your log files. 2) Model - without further information, it's impossible to say what the problem is. Describe to the bb your protein - molecular weight, how many domains, etc. Sequence identity is not the key, it's the rmsd between your model and your structure. There are examples in the literature when 100% identical model does not work even if broken into domains, although it's very likely that your problems lie elsewhere. 3) Molecular replacement - sometimes the right model is rejected because you get some conformational changes and therefore clashes. R~53% after MR usually means that you did not find a solution. Stick in a completely wrong model of the same size to get an idea of what to expect when MR fails. 4) Refinement - least likely at this point, but check for the twinning. Most of all, see if the electron density makes sense - a good test is to remove part of the model and see if it shows up in the difference map. Good luck, Ed. -- Oh, suddenly throwing a giraffe into a volcano to make water is crazy? Julian, King of Lemurs
Re: [ccp4bb] MTZ file
This sentence in my previous posting may or may not be correct technically- May be make sure about this as it says reindex because only you need to rescale it like in HKL2000. It its wrong I am Sorry in advance. Date: Wed, 14 Mar 2012 07:43:15 -0500 From: ccp4...@hotmail.com Subject: Re: [ccp4bb] MTZ file To: CCP4BB@JISCMAIL.AC.UK Mahesh, You should always use output_1.mtz for refinement. Dont use output_2. mtz for further refinement instead use some ccp4 utilities to change output_1.mtz (C222) to say output1_mod.mtz (C2221). This will become your master file for all further refinement. What ever remaining 2.mtz, 3.mtz, so on you get would only be used in coot and after the modification in coot the new model will be refined against your output1_mod.mtz (one with correct SG, now called new master file). Never use 2,3, 4, mtz files which you get after each round of refinement in next refinement. So "Am right-now using output_2.mtz, Is it right to use output_3.mtz ?" - NO Changing from 1 to 1_mod could be done in HKL2000, at scaling step or maybe reindex or pointless will do. I am not 100% sure though. May be make sure about this as it says reindex because only you need to rescale it like in HKL2000. You could use SFtools and CAD also I guess. These three in all CCP4. There may be few more in CCP4 on windows, others could give good suggestion than me. Hope this helpsRaj Date: Wed, 14 Mar 2012 16:58:34 +0530 From: mahes1...@gmail.com Subject: Re: [ccp4bb] MTZ file To: CCP4BB@JISCMAIL.AC.UK Dear crystallographers, According UMA RATU's mtz labellings, Vellieux Frederic sir answered, output of the scalepack2mtz is used as master mtz for all refining (refmac5) input(if i am wrong, sorry ). am confused when Eleanor sir answered... here my labellings !!! scalepack2mtz output_1.mtz Phaser - output_2.mtz Refmac5 --- output_3.mtz (output mtz from the refmac5 after first refining, input is phaser output_2.mtz ) As Eleanor sir told in second paragraph of his reply, i got other best possible space group by running Phaser other than scalepack2mtz space group ( i mean output_2.mtz,C2221(Phaser) from output_1.mtz, C222 (scalepack2mtz) ) .. Am right-now using output_2.mtz, Is it right to use output_3.mtz ? and from Eleanor -- "scalepack2mtz just run a jiffy to change it." how to do? am using ccp4 6.0.0 in windows xp Regards VMW On Thu, Mar 1, 2012 at 7:19 PM, Uma Ratu wrote: Many thnaks for your input. regards Ros On Wed, Feb 29, 2012 at 4:51 PM, Eleanor Dodson wrote: mtz(1) will contain h k l F SIGF I SIGI and optionally F+ SIGF+ and F- SIGF- This is your master file, providing the space group is correct It may NOT have the correct space group however - MR searches may select one space group from several possible ones. If the final SG is different from the one specified after scalepack2mtz just run a jiffy to change it. e.g. mtzutils hklin1 scal1.mtz hklout scal2.mtz symm SGname end then use scal2.mtz as your master.. The output from phaser will have the same F but after anisotropic scaling. There will be other columns suitable for input to coot the output from REFMAC will also give a scaled F plus extra columns . Always start each new refinement with your master mtz as input.. coot will automatically select the best output from PHASER or REFMAC to calculate maps. The columns FWT and PHWT are used to generate a 2mFobs-DFcalc map The columns DELFWT and PHDELWT generate a mFobs-DFcalc map Eleanor On Feb 29 2012, Uma Ratu wrote: Hello, I have a question about .mtz files used in model building. Here is how I did: Diffraction data - HKL 2000: .sca CCp4i: scalepack2mtz: .mtz (1) Phaser: In: template pdb & .mtz(1) Out: model .pdb(1) & .mtz(2) Refmac5: model .pdb(2) & .mtz(3) Here is the question: 1. Coot check and refinment: which mtz file shoudl I use? 2. With further refinemnt by refmac5, which mtz file should I use? 3. When I deposit data, which mtz file to use? 4. What is the difference between .mtz(1) and the .mtz files generated from "phaser" and "refmac"? Thank you for advice Ros -- Professor Eleanor Dodson YSNL, Dept of Chemistry University of York Heslington YO10 5YW tel: 00 44 1904 328259 Fax: 00 44 1904 328266 -- -- V . MAHESHWARAN Research Scholar, Centre of Advanced Study in Crystallography and Biophysics, University of Madras, Maraimalai campus, Guindy, Madras - 600 025 Mob : 09791767934 --
Re: [ccp4bb] MTZ file
Mahesh, You should always use output_1.mtz for refinement. Dont use output_2. mtz for further refinement instead use some ccp4 utilities to change output_1.mtz (C222) to say output1_mod.mtz (C2221). This will become your master file for all further refinement. What ever remaining 2.mtz, 3.mtz, so on you get would only be used in coot and after the modification in coot the new model will be refined against your output1_mod.mtz (one with correct SG, now called new master file). Never use 2,3, 4, mtz files which you get after each round of refinement in next refinement. So "Am right-now using output_2.mtz, Is it right to use output_3.mtz ?" - NO Changing from 1 to 1_mod could be done in HKL2000, at scaling step or maybe reindex or pointless will do. I am not 100% sure though. May be make sure about this as it says reindex because only you need to rescale it like in HKL2000. You could use SFtools and CAD also I guess. These three in all CCP4. There may be few more in CCP4 on windows, others could give good suggestion than me. Hope this helpsRaj Date: Wed, 14 Mar 2012 16:58:34 +0530 From: mahes1...@gmail.com Subject: Re: [ccp4bb] MTZ file To: CCP4BB@JISCMAIL.AC.UK Dear crystallographers, According UMA RATU's mtz labellings, Vellieux Frederic sir answered, output of the scalepack2mtz is used as master mtz for all refining (refmac5) input(if i am wrong, sorry ). am confused when Eleanor sir answered... here my labellings !!! scalepack2mtz output_1.mtz Phaser - output_2.mtz Refmac5 --- output_3.mtz (output mtz from the refmac5 after first refining, input is phaser output_2.mtz ) As Eleanor sir told in second paragraph of his reply, i got other best possible space group by running Phaser other than scalepack2mtz space group ( i mean output_2.mtz,C2221(Phaser) from output_1.mtz, C222 (scalepack2mtz) ) .. Am right-now using output_2.mtz, Is it right to use output_3.mtz ? and from Eleanor -- "scalepack2mtz just run a jiffy to change it." how to do? am using ccp4 6.0.0 in windows xp Regards VMW On Thu, Mar 1, 2012 at 7:19 PM, Uma Ratu wrote: Many thnaks for your input. regards Ros On Wed, Feb 29, 2012 at 4:51 PM, Eleanor Dodson wrote: mtz(1) will contain h k l F SIGF I SIGI and optionally F+ SIGF+ and F- SIGF- This is your master file, providing the space group is correct It may NOT have the correct space group however - MR searches may select one space group from several possible ones. If the final SG is different from the one specified after scalepack2mtz just run a jiffy to change it. e.g. mtzutils hklin1 scal1.mtz hklout scal2.mtz symm SGname end then use scal2.mtz as your master.. The output from phaser will have the same F but after anisotropic scaling. There will be other columns suitable for input to coot the output from REFMAC will also give a scaled F plus extra columns . Always start each new refinement with your master mtz as input.. coot will automatically select the best output from PHASER or REFMAC to calculate maps. The columns FWT and PHWT are used to generate a 2mFobs-DFcalc map The columns DELFWT and PHDELWT generate a mFobs-DFcalc map Eleanor On Feb 29 2012, Uma Ratu wrote: Hello, I have a question about .mtz files used in model building. Here is how I did: Diffraction data - HKL 2000: .sca CCp4i: scalepack2mtz: .mtz (1) Phaser: In: template pdb & .mtz(1) Out: model .pdb(1) & .mtz(2) Refmac5: model .pdb(2) & .mtz(3) Here is the question: 1. Coot check and refinment: which mtz file shoudl I use? 2. With further refinemnt by refmac5, which mtz file should I use? 3. When I deposit data, which mtz file to use? 4. What is the difference between .mtz(1) and the .mtz files generated from "phaser" and "refmac"? Thank you for advice Ros -- Professor Eleanor Dodson YSNL, Dept of Chemistry University of York Heslington YO10 5YW tel: 00 44 1904 328259 Fax: 00 44 1904 328266 -- -- V . MAHESHWARAN Research Scholar, Centre of Advanced Study in Crystallography and Biophysics, University of Madras, Maraimalai campus, Guindy, Madras - 600 025 Mob : 09791767934 --
Re: [ccp4bb] MTZ file
Sorry my answers were confusing.. There are two problems. 1) When you finish data processing you should have the correct point group, but you may not have the correct spacegroup (SG). You will get an mtz file after processing, but may have to correct the SG later. Eg an orthorhombic point group will have all angles 90 degrees and 2-fold symmetry around the a, b and c axis. However the space group might be one of these 8. P 2 2 2, P 21 2 2 P 21 21 2, P 21 21 21, P2 21 2, P2 21 21, P 21 2 21 or P 2 2 21. You can get an indicator of the SG from the systematic absences, but you may only be sure of it when you have solved the MR search or experimental phasing. At that point you should go back and make sure the mtz from the data processing has the correct SG in the header. 2) After any sort of manipulation your output amplitudes in the mtz file will have been modified in some way.. This file will besuitable for reading into COOT for model building. You should NOT use this file for later refinement though . Eleanor On Mar 14 2012, Maheshwaran amanthakadavu wrote: Dear crystallographers, According *UMA RATU*'s mtz labellings, *Vellieux Frederic *sir answered, output of the scalepack2mtz is used as master mtz for all refining (refmac5) input(if i am wrong, sorry ). am confused when Eleanor sir answered... here my labellings !!! scalepack2mtz output_*1*.mtz Phaser - output_*2*.mtz Refmac5 --- output_*3*.mtz (output mtz from the refmac5 after first refining, input is phaser output_*2 *.mtz ) As *Eleanor* sir told in second paragraph of his reply, i got other best possible space group by running Phaser other than scalepack2mtz space group ( i mean output_*2*.mtz,C2221(Phaser) from output_*1*.mtz, C222 (scalepack2mtz) ) .. Am right-now using output_*2*.mtz, Is it right to use output_*3*.mtz ? and from* Eleanor -- "*scalepack2mtz just run a jiffy to change it." how to do? am using ccp4 6.0.0 in windows xp Regards VMW On Thu, Mar 1, 2012 at 7:19 PM, Uma Ratu wrote: Many thnaks for your input. regards Ros On Wed, Feb 29, 2012 at 4:51 PM, Eleanor Dodson > wrote: mtz(1) will contain h k l F SIGF I SIGI and optionally F+ SIGF+ and F- SIGF- This is your master file, providing the space group is correct It may NOT have the correct space group however - MR searches may select one space group from several possible ones. If the final SG is different from the one specified after scalepack2mtz just run a jiffy to change it. e.g. mtzutils hklin1 scal1.mtz hklout scal2.mtz symm SGname end then use scal2.mtz as your master.. The output from phaser will have the same F but after anisotropic scaling. There will be other columns suitable for input to coot the output from REFMAC will also give a scaled F plus extra columns . Always start each new refinement with your master mtz as input.. coot will automatically select the best output from PHASER or REFMAC to calculate maps. The columns FWT and PHWT are used to generate a 2mFobs-DFcalc map The columns DELFWT and PHDELWT generate a mFobs-DFcalc map Eleanor On Feb 29 2012, Uma Ratu wrote: Hello, I have a question about .mtz files used in model building. Here is how I did: Diffraction data - HKL 2000: .sca CCp4i: scalepack2mtz: .mtz (1) Phaser: In: template pdb & .mtz(1) Out: model .pdb(1) & .mtz(2) Refmac5: model .pdb(2) & .mtz(3) Here is the question: 1. Coot check and refinment: which mtz file shoudl I use? 2. With further refinemnt by refmac5, which mtz file should I use? 3. When I deposit data, which mtz file to use? 4. What is the difference between .mtz(1) and the .mtz files generated from "phaser" and "refmac"? Thank you for advice Ros -- Professor Eleanor Dodson YSNL, Dept of Chemistry University of York Heslington YO10 5YW tel: 00 44 1904 328259 Fax: 00 44 1904 328266 -- Professor Eleanor Dodson YSNL, Dept of Chemistry University of York Heslington YO10 5YW tel: 00 44 1904 328259 Fax: 00 44 1904 328266
Re: [ccp4bb] MTZ file
Dear crystallographers, According *UMA RATU*'s mtz labellings, *Vellieux Frederic *sir answered, output of the scalepack2mtz is used as master mtz for all refining (refmac5) input(if i am wrong, sorry ). am confused when Eleanor sir answered... here my labellings !!! scalepack2mtz output_*1*.mtz Phaser - output_*2*.mtz Refmac5 --- output_*3*.mtz (output mtz from the refmac5 after first refining, input is phaser output_*2 *.mtz ) As *Eleanor* sir told in second paragraph of his reply, i got other best possible space group by running Phaser other than scalepack2mtz space group ( i mean output_*2*.mtz,C2221(Phaser) from output_*1*.mtz, C222 (scalepack2mtz) ) .. Am right-now using output_*2*.mtz, Is it right to use output_*3*.mtz ? and from* Eleanor -- "*scalepack2mtz just run a jiffy to change it." how to do? am using ccp4 6.0.0 in windows xp Regards VMW On Thu, Mar 1, 2012 at 7:19 PM, Uma Ratu wrote: > Many thnaks for your input. > > regards > > Ros > > On Wed, Feb 29, 2012 at 4:51 PM, Eleanor Dodson > wrote: > >> mtz(1) will contain h k l F SIGF I SIGI and optionally F+ SIGF+ and F- >> SIGF- This is your master file, providing the space group is correct >> >> It may NOT have the correct space group however - MR searches may select >> one space group from several possible ones. If the final SG is different >> from the one specified after scalepack2mtz just run a jiffy to change it. >> >> e.g. mtzutils hklin1 scal1.mtz hklout scal2.mtz >> symm SGname >> end >> >> then use scal2.mtz as your master.. >> >> The output from phaser will have the same F but after anisotropic >> scaling. There will be other columns suitable for input to coot >> >> the output from REFMAC will also give a scaled F plus extra columns . >> >> Always start each new refinement with your master mtz as input.. >> >> coot will automatically select the best output from PHASER or REFMAC to >> calculate maps. The columns FWT and PHWT are used to generate a >> 2mFobs-DFcalc map The columns DELFWT and PHDELWT generate a mFobs-DFcalc map >> >> Eleanor >> >> >> On Feb 29 2012, Uma Ratu wrote: >> >> Hello, >>> >>> I have a question about .mtz files used in model building. >>> >>> Here is how I did: >>> >>> Diffraction data - HKL 2000: .sca >>> CCp4i: scalepack2mtz: .mtz (1) >>> Phaser: In: template pdb & .mtz(1) >>> Out: model .pdb(1) & .mtz(2) >>> Refmac5: model .pdb(2) & .mtz(3) >>> >>> Here is the question: >>> 1. Coot check and refinment: which mtz file shoudl I use? >>> 2. With further refinemnt by refmac5, which mtz file should I use? >>> 3. When I deposit data, which mtz file to use? >>> 4. What is the difference between .mtz(1) and the .mtz files generated >>> from >>> "phaser" and "refmac"? >>> >>> >>> Thank you for advice >>> >>> Ros >>> >>> >> -- >> Professor Eleanor Dodson >> YSNL, Dept of Chemistry >> University of York >> Heslington YO10 5YW >> tel: 00 44 1904 328259 >> Fax: 00 44 1904 328266 >> >> >> > -- -- *V . MAHESHWARAN *Research Scholar, Centre of Advanced Study in Crystallography and Biophysics, University of Madras, Maraimalai campus, Guindy, Madras - 600 025 Mob : 09791767934 --
Re: [ccp4bb] How to reduce R factor
Dear Dipankar, It just occurred to me that your high Rfactors may also be due to a large conformational change of your protein. In that case you have to split your search model in separate pdb files for the separate domains and rund Molrep with these separate domains. Best, Herman From: CCP4 bulletin board [mailto:CCP4BB@JISCMAIL.AC.UK] On Behalf Of Dipankar Manna Sent: Wednesday, March 14, 2012 10:26 AM To: CCP4BB@JISCMAIL.AC.UK Subject: [ccp4bb] How to reduce R factor Dear Crystallographers, Can anybody guide me how to reduce R-factor, means which are the basic parameters I have to look for to reduce the R-factor during refinement. I am newly learning the refinement. After running molrep R-factor is around 53% (100% identity), after rigid body refinement its showing around 49% and after restrained refinement its showing around 47%. Highest resolution is 2.5A. Regards Dipankar This e-mail and any files transmitted with it are for the sole use of the intended recipient(s) and may contain confidential and privileged information.If you are not the intended recipient, please contact the sender by reply e-mail and destroy all copies of the original message.Any unauthorized review, use, disclosure, dissemination, forwarding,printing or copying of this email or any action taken in reliance on this e-mail is strictly prohibited and may be unlawful. Visit us at http://www.aurigene.com
Re: [ccp4bb] How to reduce R factor
Dear Dipankar, Molrep Rfactors around 50% with a model with 100% identity means that something went wrong and you did not find the solution. To find the problem, I would proceed as follows: 1) check the processing of the data and the space group: Are the statistics of the processing ok? Did you let the processing software find the space group, or did you specify it? The true space group maybe different from what you think. You may also process in P1 and let pointless figure out the space group. 2) check that you used the correct search model. It maybe trivial but if you mixed up pdb files, you will never find a solution. 3) run Molrep of Phaser with the option to test all possible spacegroups for your crystal system. During processing it is not always possible to reliable distuinguish e.g. between P212121, P21212, P2221 etc. The only way to find out is to systematically try all possibilities. All molecular replacement programs do have an option for this. 4) It may also be to you searched for too many or too few molecules. Do separate searches for 1 to as many molecules as fit in the asymmetric unit. It is not common but crystals exist with only 30% solvent or as much as 70% solvent. 5) Finally, try to find an experienced crystallographer to help you. Again, your problem is not with the refinement, but with the molecular replacement. Good luck! Herma From: CCP4 bulletin board [mailto:CCP4BB@JISCMAIL.AC.UK] On Behalf Of Dipankar Manna Sent: Wednesday, March 14, 2012 10:26 AM To: CCP4BB@JISCMAIL.AC.UK Subject: [ccp4bb] How to reduce R factor Dear Crystallographers, Can anybody guide me how to reduce R-factor, means which are the basic parameters I have to look for to reduce the R-factor during refinement. I am newly learning the refinement. After running molrep R-factor is around 53% (100% identity), after rigid body refinement its showing around 49% and after restrained refinement its showing around 47%. Highest resolution is 2.5A. Regards Dipankar This e-mail and any files transmitted with it are for the sole use of the intended recipient(s) and may contain confidential and privileged information.If you are not the intended recipient, please contact the sender by reply e-mail and destroy all copies of the original message.Any unauthorized review, use, disclosure, dissemination, forwarding,printing or copying of this email or any action taken in reliance on this e-mail is strictly prohibited and may be unlawful. Visit us at http://www.aurigene.com
Re: [ccp4bb] How to reduce R factor
Hi Dipankar If you've been reading the ccp4bb for more than a couple of weeks, you should have realised that reducing your R-factor is *not* the goal of refinement - having a low R-factor is one of the consequences of having built your model well and of having performed a good refinement. Don't try to reduce all the thousands of observations, days (weeks, months, years...) of work and thousands of pounds/ dollars/Euros,rupees to a single number. If you really don't know what you should be doing, and this is your first time, you should do the following, all of which will give you much more useful information than you can possibly get from ccp4bb. (1) Find a copy of David Blow's book "Outline of Crystallography for Biologists" and read it, especially chapter 12 (Structural Refinement). This will take no more than a couple of days if you are reasonably happy with what you are doing. (2) Find a copy of Bernhard Rupp's book "Biomolecular Crystallography" and read the chapter on "Model building and Refinement" (also, coincidentally, chapter 12). Keep the book next to you while you are learning protein crystallography. (3) Actually, this should be the *first* thing you should do. Talk to experienced crystallographers in your lab. If they are any good at all, they will explain to you what you should be doing and why. (4) Go on a course - Aurigene should find it well worth the investment in paying for their employees to attend one of the various intensive protein crystallography courses that take place around the world. At these courses, you get the chance to meet and discuss issues with global leaders in the field - and learn a huge amount. (5) (Worst option) Read past posts on this on the ccp4bb - they should only make you realise that you should have done (1) to (4) above anyway. HTH, On 14 Mar 2012, at 09:26, Dipankar Manna wrote: Dear Crystallographers, Can anybody guide me how to reduce R-factor, means which are the basic parameters I have to look for to reduce the R-factor during refinement. I am newly learning the refinement. After running molrep R-factor is around 53% (100% identity), after rigid body refinement its showing around 49% and after restrained refinement its showing around 47%. Highest resolution is 2.5A. Regards Dipankar This e-mail and any files transmitted with it are for the sole use of the intended recipient(s) and may contain confidential and privileged information.If you are not the intended recipient, please contact the sender by reply e-mail and destroy all copies of the original message.Any unauthorized review, use, disclosure, dissemination, forwarding,printing or copying of this email or any action taken in reliance on this e-mail is strictly prohibited and may be unlawful. Visit us at http://www.aurigene.com Harry -- Dr Harry Powell, MRC Laboratory of Molecular Biology, MRC Centre, Hills Road, Cambridge, CB2 0QH
Re: [ccp4bb] How to reduce R factor
-BEGIN PGP SIGNED MESSAGE- Hash: SHA1 Dear Dipankar, if you refine your model straight after molecular replacement you risk to further strengthen model bias which could result in hovering out features in your data which otherwise help you improve your model. Look at the model and the map after rigid body refinement with the model building program of your choice and improve the model as much as you can before you run any further refinement. If you do not see any features in the map deviating from the model chances are high that your MR solution is incorrect. Best wishes, Tim On 03/14/2012 10:26 AM, Dipankar Manna wrote: > Dear Crystallographers, > > Can anybody guide me how to reduce R-factor, means which are the basic > parameters I have to look for to reduce the R-factor during refinement. I am > newly learning the refinement. After running molrep R-factor is around 53% > (100% identity), after rigid body refinement its showing around 49% and after > restrained refinement its showing around 47%. Highest resolution is 2.5A. > > Regards > > Dipankar > > > > This e-mail and any files transmitted with it are for the sole use of the > intended recipient(s) and may contain confidential and privileged > information.If you are not the intended recipient, please contact the sender > by reply e-mail and destroy all copies of the original message.Any > unauthorized review, use, disclosure, dissemination, forwarding,printing or > copying of this email or any action taken in reliance on this e-mail is > strictly prohibited and may be unlawful. > > Visit us at http://www.aurigene.com > - -- - -- Dr Tim Gruene Institut fuer anorganische Chemie Tammannstr. 4 D-37077 Goettingen GPG Key ID = A46BEE1A -BEGIN PGP SIGNATURE- Version: GnuPG v1.4.10 (GNU/Linux) Comment: Using GnuPG with Mozilla - http://enigmail.mozdev.org/ iD8DBQFPYGUbUxlJ7aRr7hoRArrAAKCpS31k0HNopSponGGZ52i4nYwxZgCfWrN2 1+T+EvfljKRiKf3Q8DfosMk= =qZ5E -END PGP SIGNATURE-
Re: [ccp4bb] mammalian expression vector
Hi Jerry, You may find that pcDNA3.1 won't give you the protein yields needed for crystallization. Have a look at PMID: 17001101 for an alternative. Your Kozak sequence looks good, radu -- A. Radu Aricescu, PhD University Research Lecturer MRC Career Development Award Fellow University of Oxford Wellcome Trust Centre for Human Genetics Division of Structural Biology Roosevelt Drive, Oxford OX3 7BN United Kingdom Phone: +44-1865-287564 Fax: +44-1865-287547 Original message >Date: Tue, 13 Mar 2012 19:36:30 -0700 >From: CCP4 bulletin board (on behalf of Jerry McCully >) >Subject: [ccp4bb] mammalian expression vector >To: CCP4BB@JISCMAIL.AC.UK > > Dear ALL; > > As an alternative strategy to avoid endotoxin, > I plan to express the protein in mammalian cells. > > As suggested by others, the typical vector is > pcDNA3.1(+). Does anyone have comments on this > vector or recommend some other powerful vectors? > >I am new to mammalian expression. I designed a > Kozak sequence followed by a BSA signal peptide in > order to clone the target into pcDNA3.1(+). > > Is it right? Tentative Kozak sequence: > GAGCTCGGATCCGCCACCATGAAGTGGGTAACCTTTCTCCTCCTCCTCTTCATCTCCGGTTCTGCCCT > > Thanks a lot, > > Jerry
[ccp4bb] How to reduce R factor
Dear Crystallographers, Can anybody guide me how to reduce R-factor, means which are the basic parameters I have to look for to reduce the R-factor during refinement. I am newly learning the refinement. After running molrep R-factor is around 53% (100% identity), after rigid body refinement its showing around 49% and after restrained refinement its showing around 47%. Highest resolution is 2.5A. Regards Dipankar This e-mail and any files transmitted with it are for the sole use of the intended recipient(s) and may contain confidential and privileged information.If you are not the intended recipient, please contact the sender by reply e-mail and destroy all copies of the original message.Any unauthorized review, use, disclosure, dissemination, forwarding,printing or copying of this email or any action taken in reliance on this e-mail is strictly prohibited and may be unlawful. Visit us at http://www.aurigene.com
