Re: [galaxy-dev] Configuration of a local install - mi-deploy ?
Hi Clare, As a technical add-on - you didn't mention what type OS you're looking to install this on so I just wanted to mention that mi-deployment scripts are tested primarily on Ubuntu 10.04 LTS and thus most likely to work properly there. If you're also looking to setup the data, unfortunately the data script is fairly well out of date at this point so I am not sure how it will work. Instead, you can try using this script https://github.com/chapmanb/cloudbiolinux/blob/master/data_fabfile.py. Enis On Fri, Nov 11, 2011 at 2:09 AM, Clare Sloggett s...@unimelb.edu.au wrote: Hi Greg Ross, Thanks for this! Yes, I confused the issue by mentioning the Tool Shed, sorry - it's the binaries themselves I need to install. Essentially I think I need to follow the steps at http://wiki.g2.bx.psu.edu/Admin/NGS%20Local%20Setup , but I was wondering about mi-deployment scripts as a better way to do this, and whether that's standard practice. After looking through the scripts they really seem like the best option to me - it looks like they are set up so you mostly only need to change configuration variables to get this to work. The scripts are mentioned on the wiki instructions but don't seem to be the default option (they are not bundled in galaxy-dist), so I wondered if people are usually doing it this way? Thanks, Clare On Fri, Nov 11, 2011 at 2:06 AM, Ross ross.laza...@gmail.com wrote: Clare, As Greg says, the tool wrappers exposed on Main all come with a mercurial checkout - but all the binary dependencies, genomic data and indexes do not. The tool shed is really the tool-wrapper shed - binary and data dependencies aren't there either. I haven't tried them but I'd guess that the deploy scripts take care of a lot of messy details but will probably need some work to fit your local setup. As to email for admin - my advice would be don't worry about it - if one user forgets their password you can reset it from the admin interface - that's the main use and if this is really a test instance, it's not a show stopper. On Thu, Nov 10, 2011 at 9:14 AM, Greg Von Kuster g...@bx.psu.edu wrote: Hello Clare, On Nov 9, 2011, at 11:11 PM, Clare Sloggett wrote: Hi all, Most of our playing around with Galaxy has been in getting it working on our local cloud, but now for the first time I'm configuring a non-cloud local install of galaxy-dist (set up as per http://wiki.g2.bx.psu.edu/Admin/Config/Performance/Production%20Server ) So I have some naive questions! Would it be a sensible approach to grab the tools_fabfile script from mi-deployment and use it in this case? Or should I be using the Tool Shed for installing the base set of tools? The Galaxy distribution includes all of the tools you see on both the Penn State test and main instances. You can also get tools form the tool shed if you want - see our wiki at http://wiki.g2.bx.psu.edu/Tool%20Shedfor information about how to do this. I don't think you'll need to use the tools_fabfile script from mi_deployment repo for your local instance. Also, if I have problems with this server sending out emails (which may be the case) am I going to run into trouble with user/password management or can I just admin everything manually? There will only be a very small number of users on this server. I'm not clear on this question, but you certainly shouldn't run into any problems with user / password management within Galaxy. From the Galaxy Admin interface you have the ability to Manage users where you can reset passwords if necessary. If I have missed any good 'getting started' documentation on config/admin of a local install please point me in the right direction. I've been looking at http://wiki.g2.bx.psu.edu/Admin . You found the right wiki. Thanks, Clare -- E: s...@unimelb.edu.au P: 03 903 53357 M: 0414 854 759 ___ Please keep all replies on the list by using reply all in your mail client. To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ Greg Von Kuster Galaxy Development Team g...@bx.psu.edu ___ Please keep all replies on the list by using reply all in your mail client. To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ -- Ross Lazarus MBBS MPH; Associate Professor, Harvard Medical School; Head, Medical Bioinformatics, BakerIDI; Tel: +61 385321444; -- E: s...@unimelb.edu.au P: 03 903 53357 M: 0414 854 759 ___ Please keep all replies on the list by using reply all in your mail client. To manage your subscriptions to this and other Galaxy lists, please use the
[galaxy-dev] Local galaxy Cufflinks problem
Colleagues, We have set up a local Galaxy but I am having trouble running Cufflinks with the annotation gtf file. We have the iGenomes btau4.2 genome in the database and use the iGenomes btau4.2 gtf file in the history. However the –G isn’t showing up in the command line (below) and the output is the same as when I run cufflinks without annotation. Is something not set up correctly? Info: cufflinks v1.0.3 cufflinks -q --no-update-check -I 5 -F 0.05 -j 0.05 -p 4 -N -b /phillip/hiscansq/run00085-09-16-11_D0D1KACXX/110916_H179_0062_AD0D1KACXX/hr00206_OAR13-24/References/Bos_taurus/genome.fa The details page shows the gtf file being supplied from the history Input Parameter Value SAM or BAM file of aligned RNA-Seq reads 26: Tophat for Illumina on data 2 and data 1: accepted_hits Max Intron Length 5 Min Isoform Fraction 0.05 Pre MRNA Fraction 0.05 Perform quartile normalization Yes Conditional (reference_annotation) 1 Reference Aonnotation24: Btau42_iGenomes_annot.gtf Conditional (bias_correction) 0 Conditional (seq_source) 0 Conditional (singlePaired)0 Thanks for your help. Chris ___ Please keep all replies on the list by using reply all in your mail client. To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/
[galaxy-dev] Velvetoptimizer won't read in my paired, illumina file
Hi. I have an illumina 1.9 file that I renamed, groomed, and interlaced to get to its current state (see first 2 sets of paired sequences below) @1 TTATCTGCATATACGAAATATACATTGAAAGTTGAAATAAATGATAAATTAAACCAATTA +1 @CCCDDC?DDDFHHHGIIGJJIIIHEIJHGECIDHHHGIEGIGDHDGIHGHF4IGIHEGIIGHCFIJIHDHF4IIJIHHIGIGFHGHHFFFDF@@B @1 TTTATCTACAAGCTAATTACAAGACATACTTACTTAAGTAAATTAAGATATATGGTTAATATTGCATTAAATAAGCTTTAATAAAGAGATAA +1 @CCDFFDFHHHGHJJJIIJJJIIIJJIIJIHIGGIBHGIHIHHIGIIIGHEIIICHGGHDHGIHHDIGIIICHGGDGFEGEADECC7?CCDFD@C @2 ATTTATACATCTGTTGAACAAGTTATTAATTCTGCGATCTAATGTTATCACTTGTCCTCCCACATAGATCTTCATTCCTAAATTTATA +2 ;,(5(5((3;AC@@;3;?:DEHA;=A@55)((8)(6HGB8F?9B?99)CHGGFCC?1)8)A+EC:CAA:F@FECA+B9C:BD4DDB2+;=+B @2 TATCCATACAAACTTATCATTCACTTTCAGTAGTAACCTATTCTTAGTTTAACTTCAAATACCTTGGCCCTTCCCAAACACTATCTGACTTC +2 =8?;A=B?CFBBHGG2ACAC@@9E?F@HIIGHGI+1?E9EEDHECGHBGHIGBFHCHFG@BB8BFFHCG:=;(=@D=C3?.;=;?DECC3C(C Now I want to do an initial assembly with velvetoptimizer on my local instance of Galaxy. When I run velvetoptimizer, calling this file a fastq file of short paired reads, it fails and I get this error message: SyntaxError: unexpected character after line continuation character Any ideas on what I'm doing wrong? Thanks! -Lucinda ___ Please keep all replies on the list by using reply all in your mail client. To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/
[galaxy-dev] barcode splitter made 96 files. Is there a tool to map all of these files to the reference genome?
Hi, I have Rad tag data that I'm trying to map to our reference genome in Galaxy on our local instance. After barcode splitter, I have 96 files (one each of all of the sequences for that individual). It seems like the current tools (e.g. bowtie) can only map a single file to the reference. I think that even if I were to do this step 96 times, I would still end up with 96 files at the end and not the linkage map that I hoped for. Any ideas on how to move forward from this stage? -Lucinda ___ Please keep all replies on the list by using reply all in your mail client. To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/
[galaxy-dev] Galaxy Development Workshop: 23 January 2012, Český Krumlov, Czech Republic
Hello all, A one day Galaxy Developer Workshophttp://evomics.org/workshops/galaxy-developer-workshop/has been scheduled for 23 January in Český Krumlov http://www.ckrumlov.info/php/, Czech Republic, immediately following the Workshop on Genomicshttp://evomics.org/workshops/workshop-on-genomics/2012-genomics-cesky-krumlov/2012, (which also features Galaxy content, and is still taking applications). The Galaxy workshop is aimed at: - *IT and Bioinformatics staff:* - Galaxy is an easy to use, web-based tool that enables your researchers to perform data integration and analysis, in house, without handholding from you. This workshop will teach you how to install your own instance of Galaxy, either on your local compute infrastructure, or on the cloud. *Bioinformatics tool developers:* - Galaxy provides mechanisms for integrating your own tools and the tools of others into Galaxy instances. This workshop will cover how to define your tools in Galaxy, and how to then make those definitions available for installation in any Galaxy instance, thus making your tools much more accessible to the research community. This workshop also includes contributed talks from participants. If you have a topic of interest to the workshop’s audience, then please submit a short (500 words or less) abstract along with your registrationhttp://evomics.org/registration-form/galaxy-developer-workshop/. Topics do not have to be directly related to Galaxy, but they should be of interest to those working with the integration, analysis, and sharing of large biological datasets. *15 December is the preferred registration deadline.* However, later registration will certainly be accepted dependent on availability. The registration fee is $200 USD (payment terms provided upon acceptance). Please forward this announcement on to any interested parties. Thanks, Dave C. PS: Plans for the 2012 Galaxy Community Conferencehttp://wiki.g2.bx.psu.edu/Events/GCC2012are coming along nicely. Look for an announcement with dates soon. -- http://galaxyproject.org/ http://getgalaxy.org/ http://usegalaxy.org/ http://galaxyproject.org/wiki/ ___ Please keep all replies on the list by using reply all in your mail client. To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/
