RE: [freenet-support] Negative Local Ports
That are supposed to build up until the maximum connection limit is reached.. At that point they will start to get dropped whenever a new connection arrives.. Can this be the cause of what you are seeing? /N -Original Message- From: [EMAIL PROTECTED] [mailto:[EMAIL PROTECTED] On Behalf Of Richard Thomas Harrison Sent: den 20 november 2003 09:29 To: [EMAIL PROTECTED] Subject: Re: [freenet-support] Negative Local Ports -BEGIN PGP SIGNED MESSAGE- Hash: SHA1 Niklas Bergh randomly hit the keyboard and managed to write on 19/11/2003 09:21: | Btw. This should now be 'fixed' in latest cvs. Textual descriptions | will be displayed instead of those negative numbers. So it does (unstable 6342). However, they don't close and build up. I have sent a very large file to this list (about 230k) about this. Unsurprisingly it has been held back for approval before being posted (or not) to this list. Richard - -- - -- -- CATGACGCACTAGCGGATTCCAATCGGGTAGTTCCGCGCACTTATGCCTCAATAGATC TGCCACATCG CATGGTGATCATCCCATTCTTCGCCCGGGATATCTTAAGCAATGAAGTGTGGCATCCT TTTGCTTCAG dna.pl v0.2.4 (c) 20020613 (tm) rich at mibnet.plus.com -BEGIN PGP SIGNATURE- Version: GnuPG v1.2.3-nr1 (Windows XP) Comment: Using GnuPG with Thunderbird - http://enigmail.mozdev.org iD8DBQE/vHs9DehCPPrjI9gRAt/aAJ0Y6KfxjJdS2wptO1QmzE6fDtprxwCfVF5L T2ZD61GcG8UERF4tJjpKTZ8= =WmTa -END PGP SIGNATURE- -- ** ** This message has been swept clean of viruses by AVG Anti Virus email Scanner. http://www.grisoft.com/html/us_index.cfm Checked by AVG anti-virus system (http://www.grisoft.com). Version: 6.0.541 / Virus Database: 335 - Release Date: 16/11/2003 ___ Support mailing list [EMAIL PROTECTED] http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support ___ Support mailing list [EMAIL PROTECTED] http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support
[freenet-support] Negative Local Ports
-BEGIN PGP SIGNED MESSAGE- Hash: SHA1 For sometime now (3 or 4 weeks I think) I have been noticing -ve Local Port numbers being reported in the Open Connection Manager screen (Connection Mode). It does not seem to be associated with the remote node build since atm I have 3 connections to a node, 2 with -ve numbers and 1 with a +ve number. I might add that I have 67 other connections to other nodes before you have a heart attack. All other Local Ports are in the range of 3000 to 5000. The negative Local Port number is -5 for both. Just rechecked and all 3 connections to the node are now -5. C:\USR\LOCAL\Freenet0.5 [\\VIXEN\Richard]$ ver Microsoft Windows XP [Version 5.1.2600] C:\USR\LOCAL\Freenet0.5 [\\VIXEN\Richard]$ java freenet.Version Freenet: Fred 0.6 (protocol 1.47) build 6339 (last good build: 6280) C:\USR\LOCAL\Freenet0.5 [\\VIXEN\Richard]$ java -version java version 1.4.2_01 Java(TM) 2 Runtime Environment, Standard Edition (build 1.4.2_01-b06) Java HotSpot(TM) Client VM (build 1.4.2_01-b06, mixed mode) Will install 6340 and check with that. Probably take some time to spot it though as it doesn't happen very often. Richard - -- - CATGACGCACTAGCGGATTCCAATCGGGTAGTTCCGCGCACTTATGCCTCAATAGATCTGCCACATCG CATGGTGATCATCCCATTCTTCGCCCGGGATATCTTAAGCAATGAAGTGTGGCATCCGCTTCAG dna.pl v0.2.4 (c) 20020613 (tm) rich at mibnet.plus.com -BEGIN PGP SIGNATURE- Version: GnuPG v1.2.3-nr1 (Windows XP) Comment: Using GnuPG with Thunderbird - http://enigmail.mozdev.org iD8DBQE/uzFyDehCPPrjI9gRAhVdAJ4vKRMTQxApFfHGEnB38web3aOAgQCfb5N+ 9PrmpUDUqEeAPgXapjUw6Pk= =Qpl2 -END PGP SIGNATURE- -- This message has been swept clean of viruses by AVG Anti Virus email Scanner. http://www.grisoft.com/html/us_index.cfm Checked by AVG anti-virus system (http://www.grisoft.com). Version: 6.0.541 / Virus Database: 335 - Release Date: 15/11/2003 ___ Support mailing list [EMAIL PROTECTED] http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support
RE: [freenet-support] Negative Local Ports
Btw. This should now be 'fixed' in latest cvs. Textual descriptions will be displayed instead of those negative numbers. /N -Original Message- From: [EMAIL PROTECTED] [mailto:[EMAIL PROTECTED] On Behalf Of Niklas Bergh Sent: den 19 november 2003 10:07 To: [EMAIL PROTECTED]; [EMAIL PROTECTED] Subject: RE: [freenet-support] Negative Local Ports These are a programmatical thingy.. They tend to mean that something is wrong with the connection in question.. Maybe not fully opened yet.. Maybe on its way to closing. Check the mailing list archives for an exact description. /N -BEGIN PGP SIGNED MESSAGE- Hash: SHA1 For sometime now (3 or 4 weeks I think) I have been noticing -ve Local Port numbers being reported in the Open Connection Manager screen (Connection Mode). It does not seem to be associated with the remote node build since atm I have 3 connections to a node, 2 with -ve numbers and 1 with a +ve number. I might add that I have 67 other connections to other nodes before you have a heart attack. All other Local Ports are in the range of 3000 to 5000. The negative Local Port number is -5 for both. Just rechecked and all 3 connections to the node are now -5. C:\USR\LOCAL\Freenet0.5 [\\VIXEN\Richard]$ ver Microsoft Windows XP [Version 5.1.2600] C:\USR\LOCAL\Freenet0.5 [\\VIXEN\Richard]$ java freenet.Version Freenet: Fred 0.6 (protocol 1.47) build 6339 (last good build: 6280) C:\USR\LOCAL\Freenet0.5 [\\VIXEN\Richard]$ java -version java version 1.4.2_01 Java(TM) 2 Runtime Environment, Standard Edition (build 1.4.2_01-b06) Java HotSpot(TM) Client VM (build 1.4.2_01-b06, mixed mode) Will install 6340 and check with that. Probably take some time to spot it though as it doesn't happen very often. Richard - -- - -- -- CATGACGCACTAGCGGATTCCAATCGGGTAGTTCCGCGCACTTATGCCTCAATAGATC TGCCACATCG CATGGTGATCATCCCATTCTTCGCCCGGGATATCTTAAGCAATGAAGTGTGGCATCCT TTTGCTTCAG dna.pl v0.2.4 (c) 20020613 (tm) rich at mibnet.plus.com -BEGIN PGP SIGNATURE- Version: GnuPG v1.2.3-nr1 (Windows XP) Comment: Using GnuPG with Thunderbird - http://enigmail.mozdev.org iD8DBQE/uzFyDehCPPrjI9gRAhVdAJ4vKRMTQxApFfHGEnB38web3aOAgQCfb5N+ 9PrmpUDUqEeAPgXapjUw6Pk= =Qpl2 -END PGP SIGNATURE- -- ** ** This message has been swept clean of viruses by AVG Anti Virus email Scanner. http://www.grisoft.com/html/us_index.cfm ** ** Checked by AVG anti-virus system (http://www.grisoft.com). Version: 6.0.541 / Virus Database: 335 - Release Date: 15/11/2003 ___ Support mailing list [EMAIL PROTECTED] http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/suppor t ___ Support mailing list [EMAIL PROTECTED] http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support ___ Support mailing list [EMAIL PROTECTED] http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support
