join with header line support

Hello, I'd like to suggest a small feature for 'join': --header makes join join the first line from each file regardless of the join field and ordering. This allows joining files which have header lines in them. Example: === $ cat 1.txt ID Color Name 1 green Alice 2

Re: join with header line support

Eric, Thank you for your detailed and quick response. Eric Blake wrote, On 10/30/2009 07:23 PM: The bar is very high for adding new options, especially for burning a short option on something that doesn't have much background. That's understandable. A mixture of head -n 1 to extract the

Re: join suggestion: auto-output-format

. Thanks, -gordon Assaf Gordon wrote, On 11/04/2009 08:36 PM: This feature allows join to automatically guess the output format without specifying '-o', allowing easier use (IMHO) of -e. This is mostly a convenience, DWIM kind of feature. Here a simple use case: $ cat 1.txt 1 alice

bug#13099: possible test bug in tests/df/total-verify.sh

Hello, (properly reporting a bug I mentioned in another email). The test df/total-verify.sh fails on my system, due to a wrong(?) regex to verify the output of df --total -i -P. To make a long story short, my df produces the following line: === $ df --total -i -P Filesystem

bug#13099: possible test bug in tests/df/total-verify.sh

Correction: On 12/05/12 22:33, Assaf Gordon wrote: === $ df --total -i -P Filesystem Inodes IUsed IFree IUse% Mounted on snip //bluearctitan3/foobar0 0 0 - /media/foobar === The filesystem is mounted with fuse/sshfs (not sure

bug#13495: Compilation fails on Mac OS X 10.8.0

Hello, Trying to compile the latest coreutils on Mac OS X, I get the following compilation error: $ ./configure [ works OK ] $ make [ ... ] CC lib/stpncpy.o lib/stpncpy.c:34: error: expected declaration specifiers or '...' before numeric constant

bug#13495: Compilation fails on Mac OS X 10.8.0

More information: Assaf Gordon wrote, On 01/18/2013 05:32 PM: Hello, Trying to compile the latest coreutils on Mac OS X, I get the following compilation error: $ ./configure [ works OK ] $ make [ ... ] CC lib/stpncpy.o lib/stpncpy.c:34: error

bug#13495: Compilation fails on Mac OS X 10.8.0

On 01/18/13 19:58, Paul Eggert wrote: I'm puzzled as to why stpncpy.c is being compiled at all. Doesn't OS X have stpncpy? I would look in config.log and try to figure out why 'configure' thinks stpncpy is missing. This seems like the relevant part from 'config.log' (but more info below): ===

bug#13495: Compilation fails on Mac OS X 10.8.0

On 01/19/13 22:31, Paul Eggert wrote: Could you please try this: ./configure make clean make V=1 I'm interested in the last (failing) command executed by the last 'make'. Suppose it is like this: gcc -std=gnu99 -I. -I./lib -Ilib ... -o lib/stpncpy.o lib/stpncpy.c Please send the relevant

bug#13495: Compilation fails on Mac OS X 10.8.0

On 01/20/13 00:15, Paul Eggert wrote: On 01/19/2013 08:07 PM, Assaf Gordon wrote: Which looks like some macro expansion, but I couldn't find the declaration of this macro. Does something like the following patch fix things for you? diff --git a/lib/stpncpy.c b/lib/stpncpy.c index 466cd5f

bug#13516: tests/rm/unread3 fails on Mac OS X 10.8

Hello, Testing the latest coreutils on Mac OS X, tests/rm/unread3 fails. The immediate cause is: rm: unable to record current working directory: Too many open files Attached is the relevant part from the log file. The programs were compiled using: === $ ./configure CC=clang ## - ## ##

bug#13516: tests/rm/unread3 fails on Mac OS X 10.8

Paul Eggert wrote, On 01/22/2013 03:21 PM: On 01/22/13 11:22, Assaf Gordon wrote: 3. Running with 'sudo', 'rm' doesn't fail: $ sudo dtruss $D/rm -r $D/a $D/b 2/tmp/rm_trace.txt You need a sudo inside dtruss, to, right? Something like this sudo dtruss sudo -u $USER $D/rm -r $D/a $D

bug#13516: tests/rm/unread3 fails on Mac OS X 10.8

Paul Eggert wrote, On 01/23/2013 02:19 AM: It looks like there's no way to get the equivalent of strace, then. That's too bad. I guess you'll have to use GDB, then. Here's what I get with GDB. Seems like some weird case of endless recursion, that leads to file-descriptor exhaustion (if I

bug#13495: Compilation fails on Mac OS X 10.8.0

Paul Eggert wrote, On 01/22/2013 01:20 AM: On 01/21/2013 11:39 AM, Assaf Gordon wrote: This fixes the problem. Compilation succeeds with both gcc and clang. Thanks for checking. I pushed the following patch into gnulib and am marking this coreutils bug as done. Just a follow-up

bug#13495: Compilation fails on Mac OS X 10.8.0

Paul Eggert wrote, On 01/24/2013 04:38 PM: On 01/24/13 13:07, Assaf Gordon wrote: $ CFLAGS=-g -O0 ./configure Isn't it better to use this? ./configure CFLAGS=-g -O0 If that works, it solves your problem. No, doesn't work - same linking error. Otherwise: $ make [ ... snip

bug#13495: Compilation fails on Mac OS X 10.8.0

An ugly work-around: -O1 seems to overcome the messy macro expansion of stpncpy. So either compile everything with CFLAGS=-g -O1, Or compile everything with -g -O0 until it fails, then compile two problematic objects with -O1 and continue, Or just compile the program of interest and ignore the

bug#13495: Compilation fails on Mac OS X 10.8.0

Paul Eggert wrote, On 01/25/2013 05:18 PM: On 01/25/2013 11:25 AM, Assaf Gordon wrote: So I'm guessing that even though gnulib's stpncpy code is used, because the MacOS's native declaration of stpncpy is included, it causes problems when the macro is expanded to use __stpncpy_chk. Does

bug#13516: tests/rm/unread3 fails on Mac OS X 10.8

Global Odey wrote, On 01/28/2013 12:55 PM: On 1/27/13 8:34 PM, Paul Eggert wrote: Thanks, can you please try this patch instead? It's a bit more drastic, but I hope it fixes the loop without introducing that other bug. Thank you. Your patch does the trick on OS X 10.8.2, however, it causes

bug#13665: Question about the translation of double_to_human

Pádraig Brady wrote, On 02/09/2013 02:26 PM: On 02/09/2013 06:42 PM, Göran Uddeborg wrote: I started the translation of coreutils 8.20-pre2 which just arrived via the Translation Project. I got a bit uncertain about messages like: msgid simple_strtod_human:\n input

bug#13786: pr command does not fold

Hello, Doh Smith wrote, On 02/22/2013 05:14 AM: I could not get the pr command to fold the lines. Is this a bug? I am using pr (GNU coreutils) 8.13 under GNU bash 4.2.24. I think 'pr' does the pagination and columnation, but doesn't actual re-folds (=wraps) lines to your desired length. It is

bug#14189: ls -d bug ??

Hello Ray, Others can provide more detailed information about the rational of the dot file, but regarding your questions: r...@electronicstheory.com wrote, On 04/11/2013 02:17 PM: Once in a blue moon, a person would like to view the subdirectories of the directory you are in, without seeing

bug#14977: texinfo build fails due to missing @item, after du/inode change

Hello, Trying to compile the latest revision (v8.21-102-g9e52eba), I get the following error: === $ make snip test -f doc/.dirstamp || make doc/.dirstamp make[3]: Entering directory `/home/gordon/temp/coreutils' make[3]: Leaving directory `/home/gordon/temp/coreutils' Updating

bug#15077: Clarification

Hello Federico Alves, On 08/12/2013 12:31 PM, CDR wrote: I just found out that the v option does what I need. So in my opinion, the a option is useless, for it gives you no new information. I'm glad to hear you found the combination of options that works for you. I would humbly disagree that

bug#15077: Clarification

(CC'ing the list so that others could comment) Hello Federico, On 08/12/2013 06:50 PM, CDR wrote: How do I get latest, latest version, even beta, or join, sort, etc? I would not recommend using beta or development versions of GNU coreutils for production code, just to be on the safe side.

bug#15425: mktemp - conflicting options affected by ENV

Hello, Not sure if this is a bug or just unintended side-effect, but it caused some scripts here to fail and took a while to troubleshoot: It basically boils down to the interplay between the deprecated -t -p and $TMPDIR and --tmpdir. === ## ## Problem 1: -t and TMPDIR (if non-empty)

bug#16530: Bootstrapping fails with missing m4/cu-progs.m4

Hello, Just tried to compile coreutils from scratch, and encountered the following problem: === $ git clone git://git.sv.gnu.org/coreutils $ cd coreutils $ ./bootstrap ./bootstrap: Bootstrapping from checked-out coreutils sources... ./bootstrap: consider installing git-merge-changelog from gnulib

bug#16530: Bootstrapping fails with missing m4/cu-progs.m4

Follow-up: On 01/23/2014 11:47 AM, Assaf Gordon wrote: Just tried to compile coreutils from scratch, and encountered the following problem: === $ git clone git://git.sv.gnu.org/coreutils $ cd coreutils $ ./bootstrap ...snip... /usr/bin/m4: m4_esyscmd subprocess failed /usr/bin/m4

bug#16532: Test Fail: tests/chown/separator

Hello, Testing the latest coreutils (v8.22.16-be97f) on an old Ubuntu server, results in a test failure tests/chown/separator (log + strace below). System is: $ uname -a Linux club 2.6.32-24-server #43-Ubuntu SMP Thu Sep 16 16:05:42 UTC 2010 x86_64 GNU/Linux $ cat /etc/issue Ubuntu

bug#16532: Test Fail: tests/chown/separator

On 01/23/2014 06:20 PM, Bernhard Voelker wrote: On 01/23/2014 07:41 PM, Assaf Gordon wrote: $ strace ../src/chown 34574:users . 21 | grep -A 5 -B 5 chown fchownat(AT_FDCWD, ., 34574, 100, 0) = -1 EPERM (Operation not permitted) ++ id -g + id_g=1000 + chown 34574:users . chown

bug#16532: Test Fail: tests/chown/separator

This patch makes the test skip on my server (did not test it on other systems). On 01/23/2014 08:09 PM, Pádraig Brady wrote: On 01/23/2014 11:41 PM, Assaf Gordon wrote: So I guess this is not a bug, and can be closed. I'll just ignore this failure on this system. It is a false failure

bug#16532: Test Fail: tests/chown/separator

On 01/23/2014 09:32 PM, Pádraig Brady wrote: Actually I messed up the login in the suggestion. I think the above should be s/!=/=/ which I've done in the attached patch. If you could confirm it was skipped on your system it would be great. I'll push soon anyway. Please don't push yet - it

bug#16532: Test Fail: tests/chown/separator

On 01/23/2014 09:46 PM, Assaf Gordon wrote: On 01/23/2014 09:32 PM, Pádraig Brady wrote: If you could confirm it was skipped on your system it would be great. Please don't push yet - it doesn't work, but for un-expected reason: On my strange system For completeness, attached is the test

bug#16532: Test Fail: tests/chown/separator

. -gordon From 5fc10774383928b2fbfde33de3efb314166fe475 Mon Sep 17 00:00:00 2001 From: Assaf Gordon assafgor...@gmail.com Date: Thu, 23 Jan 2014 20:34:52 -0500 Subject: [PATCH] tests: skip chown/separator with conflicting group IDs * tests/chown/separator.sh: skip test if the user's group has

bug#18428: Bug#760861: bug#18428: Bug#760861: bug#18428: coreutils binary breaks coreutils documentation

On 09/09/2014 10:52 AM, Michael Stone wrote: On Tue, Sep 09, 2014 at 03:31:35PM +0100, Pádraig Brady wrote: It's useful to many, but I agree most don't bother with it due to the awkward non intuitive default info reader _interface_ (though pinfo is a bit better in that regard). Right. I've

bug#18681: The Linux cp command has bugs

Hello Mike, On 10/10/2014 01:25 PM, Polehn, Mike A wrote: Problem need to copy a tree of 1000s of files to another directory that is a git directory that has a whole bunch of additional build files, so diff between the directories will not do any good. This is slightly off-topic, but if you

bug#18681: The Linux cp command has bugs

Sorry, had a typo: On 10/10/2014 03:13 PM, Assaf Gordon wrote: # For each file managed by git (with 'git ls'), # compare it to the corresponding file in the other directory: git ls -0 | xargs -0 -I% diff -q % ../dpdk-1.7.1/% Should be: git ls -z | xargs -0 -I% diff -q

bug#20210: tests/df/skip-duplicates fails on Debian-kFreeBSD due to calling 'strstr(NULL, )'

Hello, A somewhat exotic test failure: On Debian/kFreeBSD 'tests/df/skip-duplicates' fails with 'df' segfaulting like so: ... ./tests/df/skip-duplicates.sh: line 113: 7741 Segmentation fault LD_PRELOAD=./k.so df ... The flow is: 1. the k.so file (inlined C code in

bug#20631: 'df/df-output ' test fails due to extra space in header line on large disk

: Assaf Gordon assafgor...@gmail.com Date: Fri, 22 May 2015 14:09:27 -0400 Subject: [PATCH] tests: df-output: accept multiple spaces in header * tests/df/df-output.sh: allow for multiple spaces in the header line of 'df', resulting from large disks. --- tests/df/df-output.sh | 2 +- 1 file changed, 1

bug#21312: Help bug

tag 21312 notabug close 21312 stop Hello, On 08/21/2015 11:34 AM, Int wrote: tail -1000 /var/log/syslog |grep named Respond Aug 20 23:06:17 ns2 named[4247]: adjusted limit on open files from 1024 to 1048576 Somebody knows like solving it I assume that you are looking for help regarding

bug#20936: suggestion for a 'wart-ish' extension off of 'sort'

Hello, On 06/30/2015 03:28 AM, Linda Walsh wrote: I admit the ability to show a summary line might not bethe first thing you'd think a pure-sorting utility might do, but it would be awfully handy if sort had a 'Numeric sum' option (-N -- preferred '-s', but it's already taken) to go with the

bug#21236: printf version output not working

tag 21236 notabug close 21236 stop Hello, On Tue, Aug 11, 2015 at 09:40:39AM -0400, Shawn Welch wrote: The printf man 1 page says that it has a --version switch to output version but it fails and exits 1. It is likely that you are seeing the shell's built in printf instead of coreutils'

bug#21218: ls -d

Hello Eddie, On Aug 10, 2015, at 19:24, Sneeh, Eddie eddie.sn...@roche.com wrote: I guess what it boils down to is -d is a confusing choice of option for what it really does. ls --directory has little to do with directories, (and adding the word themselves to the definition doesn't really

bug#21218: ls -d

Hello Eddie, (replying to your two last messages together) On Mon, Aug 10, 2015 at 12:09:21PM -0700, Sneeh, Eddie wrote: Hi Eric, thanks for the quick response and clarification. I wasn't completely clear what -d was supposed to do exactly. The man pages define ls -d as: *list directory

bug#21130: test fail: 'tests/ls/stat-failed'

+ rm -rf /data/research/erlich_lab/gordon/sources/coreutils-8.24/gt-stat-failed.sh.LdZJ + exit 1 FAIL tests/ls/stat-failed.sh (exit status: 1) From 213564fc8c82cd5c48a1572b1a35e1780a4f245a Mon Sep 17 00:00:00 2001 From: Assaf Gordon assafgor...@gmail.com Date: Fri, 24 Jul 2015 17:27:04 -0400 Subject

bug#21130: test fail: 'tests/ls/stat-failed'

Hello, On Jul 25, 2015, at 13:13, Pádraig Brady p...@draigbrady.com wrote: On 24/07/15 22:46, Assaf Gordon wrote: Then tries to dereference it: $ ls -Log d ls: cannot access d/s: Permission denied total 0 d? ? ?? s ... Yes good point. So it must

bug#21130: test fail: 'tests/ls/stat-failed'

On 07/25/2015 07:57 PM, Paul Eggert wrote: Assaf Gordon wrote: it seems that the returned type is always 'directory': ... Is the bug reproducible on a more-modern Linux kernel? ... If the bug doesn't appear in 3.2 or newer, I wouldn't worry about it. Thanks for the pointer - on another

bug#21096: Useradd, usermod do not use the target to read groups from when using the -R parameter

Hello, On 07/20/2015 04:12 AM, Olliver Schinagl wrote: ... It appears both usermod and useradd use the local /etc/group rather then what is supplied via the -R parameter. ... Am I doing something wrong or is this indeed a bug in the coreutils? It might be a bug, but not in coreutils - these

bug#21098: uname man page

tag 21098 notabug stop Hello, On 07/20/2015 03:26 PM, Norbert de Jonge wrote: Maybe someone has time and energy to make some minor improvements to uname's man page. The problem lies in the vagueness and similarity of the options -m, -p and -i, combined with the program's unpredictable output.

bug#22109: Sort gives incorrect order when changing delimiters

tag 22109 notabug close 22109 stop Hello Ed, On 12/07/2015 10:36 AM, Ed Brambley wrote: The following problem came to light following a StackOverflow question [1]. The lexical ordering of sort appears to depend on the delimiter used, and I believe it shouldn't. As a minimal example: ###

bug#22057: Sort missing feature proposed

tag 22057 notabug close 22057 stop Hello Federico, On 11/29/2015 04:33 PM, Saint Michael wrote: I suggest that we add a new flag to Sort, to skip certain number of lines from the sorting and copy them verbatim to the output, This feature has been previously discussed, and the current

bug#22084: Potential Bug in sort -r

tag 22084 notabug close 22084 stop Hello Adrià and Deimos, On 12/03/2015 07:30 AM, Adrià Rovira wrote: I noticed the reverse option is not correctly applied if it has to sort by more than one column. This is not a bug, but simply a usage issue. The "sort --help" page states: " ... OPTS is

bug#22185: Operation not permitted for `touch -d` on 777 file

tag 22185 notabug close 22185 stop Additional information: On 12/16/2015 01:19 PM, Assaf Gordon wrote: Hello, On 12/16/2015 09:39 AM, Silvio Ricardo Cordeiro wrote: The following code fails whenever the specified date is different from `now`: <...> I see no descr

bug#22185: Operation not permitted for `touch -d` on 777 file

Hello, On 12/16/2015 09:39 AM, Silvio Ricardo Cordeiro wrote: The following code fails whenever the specified date is different from `now`: $ mkdir testdir; chmod 777 testdir; cd testdir $ touch file; chmod 777 file $ su another_user $ touch -d 'now' file # works $ touch -d 'yesterday' file

bug#22275: a before null

tag 22275 notabug close 22275 stop Hello Gregory, On 12/30/2015 10:46 AM, gregory mott wrote: in what circumstances is this a sensible and/or desirable result?: $ sort -V< 7.7z > 7a.7z > eoi 7a.7z 7.7z GNU sort's "-V" option is modeled after Debian's version sorting algorithm, explained

bug#22236: Not exactly a bug...

tag 22236 notabug close 22236 thanks Hello Todd, > On Dec 25, 2015, at 13:37, Todd Shandelman wrote: [...] > So it looks like that for chars, 'uniq' has options to compare only the first > N chars, or *all but* the first N chars. > > Whereas for fields, 'uniq'

bug#22031: Bug in rm command

tag 22031 notabug close 22031 stop Hello, On 11/27/2015 09:03 AM, Sneha Mishra wrote: Steps to get the error: >cd ~ >mkdir some_directory >cd some_directory >vi ~ "enter some text" then Press :wq! >rm -rf ./* Your home directory gets deleted. I am not able to reproduce such

bug#22042: don't say K bytes on both head and tail's man pages

On 11/28/2015 06:16 PM, Pádraig Brady wrote: On 28/11/15 23:02, Bernhard Voelker wrote: The archives (http://lists.gnu.org/archive/html/coreutils/) start 2010, so does anyone remember why K would be less ambigous than N? The mailing list split around then: I remember having slight

bug#22045: expr substr returns with an error code 1 when the substring starts with 0

tag 22045 notabug close 22045 stop Hello, On 11/28/2015 03:47 PM, Matthias Klose wrote: found with coreutils-8.23, expr substr returns with an error code when the substring consists of only '0' characters, and the match is started at position 1. $ expr substr 1234 1 4; echo $? 1

bug#22057: Sort missing feature proposed

Hello, > On Nov 30, 2015, at 15:03, Bernhard Voelker wrote: > > On 11/30/2015 06:46 PM, Saint Michael wrote: >> why don't we just go ahead and do it? > > not everything which can be done makes sense to do, and even > less if the functionality is already there.

bug#22001: Is it possible to tab separate concatenated files?

Correcting myself: On 11/23/2015 05:02 PM, Assaf Gordon wrote: If you have a file (one file) with spaces and you wish to convert them to tabs, consider the 'expand' command (then pipe to 'cat' if needed). "unexpand" will convert spaces to tabs, "expand" will convert tabs to spaces.

bug#22001: Is it possible to tab separate concatenated files?

tag 22001 notabug close 22001 stop Hello Kim, On 11/23/2015 03:50 PM, Macdonald, Kim - BCCDC wrote: I’m just looking at the options for the cat command – I see there’s a way to ignore tabs when they exist – but is there a way to tab separate the files you’re concatenating with the cat command?

bug#22001: Is it possible to tab separate concatenated files?

Hello Kim, On 11/23/2015 06:09 PM, Bob Proulx wrote: Macdonald, Kim - BCCDC wrote: For Example: Concatenate the files like so: gi|452742846|ref|NZ_CAFD01001.1| Salmonella enterica subsp., whole genome shotgun sequenceTTTCAGCATATATATAGGCCATCATACATAGCCATATAT

bug#23665: spaces in keys: doc, --debug in LC_ALL=C

Hello Karl and all, > On May 31, 2016, at 19:15, Karl Berry wrote: [...] > I'm not sure what you mean by [...]. The %lu? > Are you proposing to just add the word "sort"? That's not needed IMHO. I was suggesting exactly that :) Also, the word "key" appears in few other

bug#23665: spaces in keys: doc, --debug in LC_ALL=C

Hello Karl! On 05/31/2016 02:32 PM, Karl Berry wrote: I run LC_ALL=en_US.UTF-8 sort --debug -k 2 /tmp/foo # or -k 2,2 et al. And get the nicely explanatory output for the "surprising" result: [...] Just to verify, the surprising result is in C locale? I'm seeing the following, for

bug#23673: wrong sorting order

tag 23673 notabug close 23673 stop Hello Alain, On 06/01/2016 09:16 AM, alainm wrote: I need to perform a sort based on the first 3 indexes of a line (sort -k 1,3 -n truc.lst): The 0 coordinates are not placed before the 2 coordinates, it looks like the spaces are ignore: [...]

bug#22584: cp could be more precise than "Not a directory"

Hello Dan, A bit more technical information (though not a resolution): On 02/07/2016 11:19 AM, 積丹尼 Dan Jacobson wrote: $ cp .profile /tmp/My_DocVments/ cp: cannot create regular file '/tmp/My_DocVments/': Not a directory Well can't it be more precise: No such directory nor file. This is in

bug#22487: tests failures for coreutils-8.25 on AIX-7.1

Hello, The following tests fail on AIX-7.1: FAIL: tests/misc/kill.sh ... ++ env kill -l 15 + test EXIT = TERM + fail=1 FAIL: tests/misc/stdbuf.sh == ... *** exp Thu Jan 28 10:06:22 2016 --- out Thu Jan 28 10:06:25 2016 *** *** 1

bug#22464: compilation fails on AIX-7 (undefined symbol .rpl_malloc)

Hello, On 01/25/2016 11:57 AM, Assaf Gordon wrote: compiling 8.25 on AIX-7 fails with "undefined symbol .rpl_malloc". I'll be able to investigate further a bit later, but this seems similar to: https://debbugs.gnu.org/cgi/bugreport.cgi?bug=12841 === $ ./configure

bug#22489: A bug in tail.c

tag 22489 notabug close 22489 stop Hello WangLei, Thank you for the report, however this is not a bug. On 01/29/2016 07:38 AM, Lei Wang wrote: Version: GNU Coreutils 8.20-8.25 ​ File: tail.c Bug description: Line 1979, parse_obsolete_option() function has three parameters: argc, argv,

bug#22439: date -d @0 +%X returns 01:00:00

tag 22439 notabug close 22439 stop Hello, > On Jan 22, 2016, at 19:27, Karl Thomas Schmidt > wrote: > > If i specify -d 1970/1/1 it returns proper value of 00:00:00 This is not a bug, but simply a side-effect of ignoring your local timezone. Using '-d @0'

bug#22464: compilation fails on AIX-7 (undefined symbol .rpl_malloc)

Hello, I just got access to an AIX machine, compiling 8.25 on AIX-7 fails with "undefined symbol .rpl_malloc". I'll be able to investigate further a bit later, but this seems similar to: https://debbugs.gnu.org/cgi/bugreport.cgi?bug=12841 regards, - assaf. === $ ./configure $ make V=1

bug#22455: sort-V not sorting correctly when minor version decimal places differ

tag 22455 notabug close 22455 thanks Hello, > On Jan 24, 2016, at 07:54, Vashti wrote: > [...] > I understand that sort -V is not reliable in all cases, but this seems like > quite a straightforward one. "sort -V" is reliable (or at least - consistent and well defined in

bug#22696: ls output changes considered unacceptable

their own version with the old style quoting. (this patch is a proof-of-concept, not well tested or syntax-checked). Comments welcomed, assaf >From 2a216acd3a52f577880d3a8e02eb5dfc2358adf7 Mon Sep 17 00:00:00 2001 From: Assaf Gordon <assafgor...@gmail.com> Date: Tue, 16 Feb 2016 17:20

bug#23268: sort ant uniq bug report

(adding debbugs mailing list) Hello, On 04/11/2016 12:43 PM, 126 wrote: Thank you for your reply. I'm sorry for not describe my problem clearly. Every other input is working well,but when my input contain several lines of "src/table/checkpoint/checkPointInfo5000.lua". The result of (sort -u)

bug#23268: sort ant uniq bug report

tag 23268 notabug close 23268 thanks Hello, On 04/11/2016 06:49 AM, 126 wrote: hello, Gentleman when I use sort and uniq, and input like this below, I got wrong output: [...] "|sort -u [...] no result when I use `uniq -u` This is due to wrong usage of 'uniq -u'. The meaning of '-u' in

bug#23035: date: regression in timezone printing (+%Z)

6 = 0x0 (gdb) n 497 zone = ""; >From this point on, 'zone' is an empty string, and that's what is printed by 'date'. Not sure where to start at fixing it, but I hope the attached patch can be used to test it. Happy to test things further if needed. regards, - assaf Fr

bug#22879: Typo on ls man page

tag 22879 notabug close 22879 stop Hello Antonion, On 03/02/2016 04:20 AM, Antonio Morell wrote: there is a typo in the man page of command *ls*. It incorrectly states -l in the explanation: -h, --human-readable with -l, print sizes in human readable format (e.g., 1K

bug#23190: wc - Different output

tags 23190 notabug close 23190 thanks Hello Seva, On 04/01/2016 06:02 PM, Seva Adari wrote: I am not sure if this a bug or expected behavior! Here is different output from each run variation of wc invocation: wc -l test.txt Output: 20 awk

bug#23556: sort(1): misleading description of option -n

Hello Carsten, On 05/14/2016 10:17 AM, Carsten Hey wrote: the man page sort(1) contains a misleading description of the option -n: [...] $ man sort | grep -A1 -- --numeric-sort | sed -n -e 's/^ *//' -e '1!p' compare according to string numerical value [...] This description reads

bug#23448: stdbuf exit code does not reflect child status

Hello, On 05/04/2016 10:48 AM, Larry Wilson wrote: How can I get the exit status of the command I am running? I'm not able to reproduce this error. Notice the following: $ stdbuf -oL false && echo ok || echo fail fail $ stdbuf -oL true && echo ok || echo fail ok $ stdbuf -oL sh

bug#23448: stdbuf exit code does not reflect child status

tag 23448 notabug thanks Closed based on off-list response from submitter. -assaf

bug#24054: tr bug? [:space:] acts like "a"

tag 24054 notabug close 24045 stop Hello, On 07/22/2016 02:58 PM, p...@tutanota.de wrote: For the last few weeks tr [:space:] isn't working the way it used to for me under Ubuntu 14.04. Instead of acting on spaces it acts on "a"s.: me@U:~$ echo "thisstring abcde what the heck?" | tr

bug#23951: sort -k1.4,1.6n -u HAVE BUGS!!!

tag 23951 notabug close 23951 stop Hello, quoting an off-list email from David: > When I use "sort -k1.4n -u", system output miss [c3m1.ecld.com]. > then "sort -k1.4n aa |sort -u" the [c3m1.ecld.com] appear again. This is not a bug but correct behavior. The parameter "-k1.4n" means that the

bug#24011: parallel find error

tag 24011 notabug close 24011 stop Hello, > On Jul 16, 2016, at 15:42, jklowden wrote: > > There appears to be an error in the parallel execution of find. I > created a minimal example below. > > [...] > > $ find .. -type f -name lx[tr]\*.1 -exec basename {} + >

bug#24011: parallel find error

tag 24011 notabug close 24011 stop Hello, > On Jul 16, 2016, at 15:42, jklowden wrote: > > There appears to be an error in the parallel execution of find. I > created a minimal example below. > > [...] > > $ find .. -type f -name lx[tr]\*.1 -exec basename {} + >

bug#23951: sort -k1.4,1.6n -u HAVE BUGS!!!

Hello, > On Jul 11, 2016, at 21:38, David Pan wrote: > > It seems that I find a bug when using the command: > > sort -k1.4n -u > please refer to the attachment for detail . You have not indicated exactly what is the suspected incorrect output. May I ask you to detail what

bug#23922: cut fails for non-delimited input lines with -f 2

tag 23922 notabug close 23922 stop Hello Jens, > On Jul 8, 2016, at 19:05, Jens Mueller wrote: > > $ echo "abc" | cut -f 2 -d " " > > and I expect the empty line as output but you get "abc\n". It is not a bug, but correct behavior (though perhaps unexpected) to print

bug#25832: split (v 8.25) with numeric suffixes beyond 89

> On Feb 21, 2017, at 22:32, Pádraig Brady wrote: > > This was discussed at http://bugs.gnu.org/20874 Missed that - sorry. I should've looked through the archives first... > I'm not sure anything needs to be done here, > since for backward compat for concat operations >

bug#25870: give an example to show what lines join -a and -v are talking about

> On Feb 27, 2017, at 16:02, Assaf Gordon <assafgor...@gmail.com> wrote: > [...] > > I've added all combinations to the 'unpaired lines' section, > and also added the examples from your website to a new section "Set > operations on files". > > Comm

bug#25870: give an example to show what lines join -a and -v are talking about

Hello Dan, > On Feb 25, 2017, at 08:20, 積丹尼 Dan Jacobson wrote: > [...] > And in fact give an example to show what lines -a and -v are talking about! > Good idea. Here's a rough draft. comments welcomed, - assaf 0001-doc-expand-join-section.patch.xz Description: Binary

bug#25870: give an example to show what lines join -a and -v are talking about

Hello, Thank you for your good comments. > On Feb 27, 2017, at 05:26, 積丹尼 Dan Jacobson wrote: > > but it seems at the beginning there still lacks the > most basic "Hi kids, here is the 'join' command [...] before you get into any > more niceties. I like this approach.

bug#24349: Linux info date example

Hello, On 09/01/2016 08:40 AM, Sergiu Druta wrote: ~$ date -d 1may '+%B %-d In above example there is a single mark quotation ( ' ) missing at the end of example. Thank you for the report. The attached patch (in your name) adds the quote. If you approve, and there are no other comments,

bug#24601: Update

Hello, On 10/04/2016 11:27 AM, Paul Eggert wrote: On 10/04/2016 07:12 AM, mathew wrote: I reported the issue to the glibc maintainers, but they seem skeptical. They don't sound that skeptical to me. They just want a test case that

bug#24601: Update

Hello, Attached is my test program for strcoll. It is slightly big, but mostly because of additional help and debug printing. This will also become relevant when we deal with multibyte sort/join/uniq later on. From brief testing, it seems glibc with UTF-8 locales is the only libc that has

bug#24599: Cannot process files named -

tag 24599 notabug close 24599 stop Hello, On 10/03/2016 02:12 PM, João Miguel wrote: I initially thought this was not a bug (found no report about this in these mailing lists while searching for «file named ""-""»), but it works as expected with vi ("vi -" tries to read stdin, "vi -- -" edits

bug#24800: expr 8.25 seems to treat 0 in character class in paren incorrectly

Hello, On 10/26/2016 12:15 PM, Paul Eggert wrote: There's no bug here: "expr E" exits with status 1 if E evaluates to 0, and expressions like "0 : '\([0-9]\)$'" do evaluate to 0. Worth mentioning that this is a known "gotcha", explained here:

bug#24906: gnu sort, what am I doing wrong?

Hello Arnold, > On Nov 8, 2016, at 23:23, Arnold Robbins wrote: > > $ grep -v ^# checkbook.txt | sort -t: -k5 -k6rg > [...] > Why aren't these sorted by amounts in descending order? > What am I missing? The option "-k5" means "field 5 till the end of the line", which

bug#24730: rmdir/mkdir error(s) and/or not working "reciprocally" w/each other

Hello, Before deciding on the wording, it's worth nothing that the errors and reasons for the errors are different between mkdir and rmdir, and between the two cases. On 10/18/2016 03:49 PM, L. A. Walsh wrote: mkdir -p ./a/b/c # no error rmdir -p ./a/b/c # get error msg, but a,b,c

bug#24730: rmdir/mkdir error(s) and/or not working "reciprocally" w/each other

Hello, > On Oct 18, 2016, at 17:35, Linda Walsh <coreut...@tlinx.org> wrote: > > Assaf Gordon wrote: >>> rmdir -p ./a/b/c # get error msg, but a,b,c removed. > I see... so in ".a/b/c", a,b,c are removed, but the error > comes in "."? Yes

bug#24924: pr has no concept of wide characters

severity 24924 wishlist tags 24924 wishlist notabug thanks Hello Dan, On 11/11/2016 11:10 AM, 積丹尼 Dan Jacobson wrote: The pr documentation (man, info) doesn't mention how it has no concept of wide characters. $ pr -m --sep-string='^^^' file file Indeed, most of the current coreutils

  1   2   3   4   5   6   >